For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:143764495-143764605 111bp CAGCTCAGGAAGGACCCACT GGCCACTCTCTACACTTGGTG
Mut= 116 bp
Wt= 111 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GACTCTGGAAGCTGCAGGCTCTTGCTTTCCACACTCGGGGCACAGCAGCTTCGTAGTGAACACTGTCACCCTTTGCAGGGGCCTCCCAGAGCACCCACGGAAGCCAGCCAGGATGTTCTCCATattcaacatctggggcacattcaacaaagtgctcttcttcctcagcctcactgtcagccttgcagggctggtgggcaacgctctgctgctctggcacctcggtctgcacattaagaagggacccttcaacacctacctgctgcacctggctgctgccgatttcctcttcctctcatgccaagttggcttctctattgctacgatcgtgtcgggccatgaggacacactctacttcccagtcaccttcctgtggtttgccgtggggctctggctgctggctgccttcagtgtggactgttgcctcgcctacatgttcccctccttttgcagccccaaccgccgtcccaggttcacttcagttgtcctctgcctcgtgatctgggccctgaccatgccggccgtgctgttgccagccaacgcctgtgggctgctaaaaaacggaatgagtctgctggtctgcctcaagtaccattggaccagtgtcacctggctagcggtactgtctggcatggcatgtggggcaagcaagtttctcttaatctttgggaactgctgctcttcacagccaccccccaagttctgcaagttggcccagtgctctgggatccttctgttcttctgtcgcctacccctggttgtctactggtgcctgcggccagtcttaaaattcctgctccccttcttctttccactggccaccctcctggcctgcattgacagcagtgcaaagcccctcttgtactacatgaagggcaggcagctcaggaaggacccactgcaggtagccctaaacagggctctaggggaagagtcccagtcAGGTCTTGGGGGGCTATCCTTGCCCATGCACCAAGTGTAGAGAGTGGCCATTATACGCCCACCTACCCTGCCCTCAGAGCTGCCAGGGGGTCCCAGTCTTGCTCAAACCTTTGCG
This mutation is a 819 bp deletion beginning at Chromosome 7 position 143,764,544 bp and ending after 143,765,362 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42883 | CAG CTC AGG AAG GAC CCA CT | Wild type Forward | A | |||
| 42884 | GGC CAC TCT CTA CAC TTG GTG | Common | A | |||
| 42885 | TGA ACA CTG TCA CCC TTT GC | Mutant Forward | A | |||
| 42886 | Fluorophore-1 | CAG GGC TCT AGG GGA AGA GT | Quencher-1 | WT Probe | ||
| 42887 | Fluorophore-2 | CCA GGA TGT TCT CCA TAG GTC TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42883 | 0.40 uM |
| 42884 | 0.40 uM |
| 42885 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.