For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:69879468-69879560 93bp CCCTGAAGACCTTCTGAACTC CTGACTCATCCCCCTCCTCT
Mut= 84 bp
Wt= 93 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TCTGAACGTTACCACCCAATTCTTTCCAAACCCCCAAATATCTGCTTTTTCCTTCTCCTTGCCTGTCTCTTATATTACCCAAAATTTCCCCCCCTCCTGTGTCCTCTTTACCCCCTTCCTTTGGGGGTCCCGTGACCCTAAATGTGGGGGGAACACTATATTCCACTACACTGGAGACCCTGACTCGCTTCCCAGATTCCATGCTGGGGGCCatgtttagggctgacaccctaatgccagccaaccttaacccgcaaggagatggccattacttcatcgacagggatggcaaggctttccggcacatcctcaattttttgcggctaggccgtctggacctgccccgtgggtacggagaaactgcccttcttaaggcagaggctgacttctaccagatccggcccctcctggatgccctgcgggaattggaagcctctcggggtacacctgcatccacagccgccctactccatgcagatgtagatgtcagcccccgccaggtgcacttctccgctcgaaggggcccccaccactatgagctgagctctgtccaggtggacaccttccgagccaacctcttctgcactgaccctgagtgtctggctgccatgcgcaacagatttggtgtggccattggggacagggcagaaggaggtccacattttcggctagagtgggcctcccgcccccaggaactccctgaagtagagtatcaaagactggggctgcagccactgtggactggggggccagaagatcgtcgggaggtagcgaacacgcctacattcctggaggaggtgctacgggtggctctggaacatggcttccgcctggactctgtcttcccagaccctgaagaccttctgaactctagatccttgcgctttgtgcgccactgagggtgctgccCTCCACTTGACTGCAGAGGAGGGGGATGAGTCAGCCAAGGGGCCTGTGGCTCTTCTAAAACCTCTTTCTAGTACTGGTGTGGTAGCTATGAAAGTCAGGGATTCCACCATACCTGGCCAGAGCCTAGAGCTGGGGTTCCCAGATCGAGCTGCCCCCTTCCACCCCACAAGACTCACGAATGGT
This mutation is a 697 bp deletion beginning at Chromosome 11 position 69,879,502 bp and ending after 69,880,198 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42867 | CCC TGA AGA CCT TCT GAA CTC | Wild type Forward | A | |||
| 42868 | CTG ACT CAT CCC CCT CCT CT | Common | A | |||
| 42869 | CCA CTA CAC TGG AGA CCC TGA | Mutant Forward | A | |||
| 42870 | Fluorophore-1 | CGC TTT GTG CGC CAC T | Quencher-1 | WT Probe | ||
| 42871 | Fluorophore-2 | TGG GGG CCC TCC ACT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42867 | 0.40 uM |
| 42868 | 0.40 uM |
| 42869 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.