For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr13:34128761-34128880 120bp TCGTGTTCGGTGAGTATGTG CTTAGGCGCCACTGCTATGT
Mut= 118 bp
Wt= 120 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGCAGCTGTTCTCATGGGAAACCGCCCAGTTTCAACTTTCTGATCCTCTACAATGCAAGCCCTAAGGCTGTGCCTGGGTCATGCCACTCATTAAAGCTTCGGCAACGTCCTGTTGTCAAAACTGTGGGTGATGGGGGGGCTGCTCATTGAGAttgggggtagggttgtgcatagctaaatacagtctttttatgtcacagttttgggaggtcatcagtgatgagcatggtatagaccccactggaagttaccatggagacagtgatttgcaactggaaagaatcaatgtatactacaatgaagcaactggtaattacttttaacaccccatcttcaattctggcatccctaagctctgctcttatttgaacccaggagaaggtggcttattttaggatgaccatttttggggtggggtagcctcttctgtgccaaccaaaccctttgaaagcttggtcataatagacctttctttgtttgggggtaccaccaaacaggaaggaggtgggaccgagccctactctatagaagatactgcctggagggctaagccagctcttgttcttctgcaggtaataaatatgtgcctagggccatcctggtggacctggagccaggcacaatggactcagtcaggtctggaccatttgggcagatcttcaggccggacaacttcgtgttcggtgagtatgtggcatagctgaagacagaagagcacaaggtgttaattatcactagcacaaagggTGGAGGAGTGTGATAGACAGGGAGCATACATAGCAGTGGCGCCTAAGCCTTATCAGGCTTTGAGGCAATTGCATCTTAGCTTTTTCAAAGGCAGGTGTGCTCTGTTAACTCATTTATAATTGTATTGATAACCAAATAGTTTATTGCTTTATT
This mutation is a 595 bp deletion beginning at Chromosome 13 position 34,128,808 bp and ending after 34,129,402 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42858 | TCG TGT TCG GTG AGT ATG TG | Wild type Forward | A | |||
| 42859 | CTT AGG CGC CAC TGC TAT GT | Common | A | |||
| 42860 | TGC CAC TCA TTA AAG CTT CG | Mutant Forward | A | |||
| 42861 | Fluorophore-1 | CTG AAG ACA GAA GAG CAC AAG GT | Quencher-1 | WT Probe | ||
| 42862 | Fluorophore-2 | CTG CTC ATT GAG ATG GAG GAG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42858 | 0.40 uM |
| 42859 | 0.40 uM |
| 42860 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.