For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:110870914-110870998 85bp CACTTGCTTCTTTGAGCCTTG GATCAGAGTCCCAGACCGTGT
Mut= 92 bp
Wt= 85 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ACCCATGTAGTCCAGGCGTAGGGCTCTATTGGGAGACGAGAGCAAAACCAGTCTACCAGGCAGCACACCTGGCTCATGAAACAGGCCTTGCCTTGTCTCTGGCCTTGGTCCTGAGACCCCATCCGCGCTGACTAGGACAGACTGTCCACACTTGCTTCTTTGAGCCTTGTTTCCCCAAGCATCAACCACCcttcgagtccaagtccctggtgacacggtctgggactctgatcagtgctcttattctgaatcttggatttttttttgaggtctagggtgttggttgtgaatgtctgaaaccttttggggattctaaaatgtgtgggctgagtctttgctgaccccatcccagcctgctagcctgggcctggctcactctgttctctcttgacccacagcccagcaccgcaccgccaaagcccaagccgcccccactgaccaaggagactgtggtgttctgggacatgcgcctgtggcacgtggtgggcatcttttcgctcttcgtgttgtccatcagtgagtagctgtgccctgccctctccaccccaccacaggaggaacacagcccttctagcatccctggcccctaccgtatgccttgggttcagagctgcaattctgggcagttcaaataggctaagcacgcacaagaggcccaccgtggtctctggcacctcctcagtcacacaaagtccctgtggagggctgacgggccagcggtgacccaaagatttctgctgggcccagggaagcagccacatggcaattatgttaattataggggactccaactgaatcCAGGACATGTCATCTTTCCTATGGCTGGCTTCCTGATGCTTTTCTTGCACTTTGGCCAATTCAGGGAGCCCACACCCAGGGGCCCCAGCAAGGCCAGCCTCCACCAGAGGCTCCCCAGACGCCGAGCAGAGGCGGCTTCCAGACCCTGAGCCCTACCTCTTCAACTGCCATTTTC
This mutation is a 608 bp deletion beginning at Chromosome 9 position 110,870,349 bp and ending after 110,870,956 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42365 | CAC TTG CTT CTT TGA GCC TTG | Common | A | |||
| 42366 | GAT CAG AGT CCC AGA CCG TGT | Wild type Reverse | A | |||
| 42367 | GTG CAA GAA AAG CAT CAG GA | Mutant Reverse | A | |||
| 42368 | Fluorophore-1 | TCG AGT CCA AGT CCC TGG T | Quencher-1 | WT Probe | ||
| 42369 | Fluorophore-2 | ACC ACC CAG GAC ATG TCA TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42365 | 0.40 uM |
| 42366 | 0.40 uM |
| 42367 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.