Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr8:122440060-122440191 132bp CCAGGACCAGGTGATTGTG TGTGTGTGGATGAGGAGACA
Mut= 134 bp
Wt= 132 bp
Fam=Mut
Hex=Wt
Wt Sequence (deletions in lower case):
CGGTGCTCTTAACCACTGAGCCATTGCTCCAGCCCTTTCTGGGAGATTTGACTGTGCTTGGGGTCGCGGGAGTCCTGGGCAGAGGGGCCGTTCTGATCGGTACCAtctgggacacggtcaggacccggactcctctgggcggacaagcaggtggaggagatagaccaccagccacataggcacatgattcctggtaaacgccctcggctgtatctgggcagtgagagaaagaaggaggaagtgtgaattagaagtggactggtcccctacctccactgtgctctgggaaggttcactgagctttgagtctgctgccaatttaggaggtcttcctgaggttgtgtagtgagaggggatggagcactgaggggaggaccaggaactcactgcttcggttgttgtttcaggggggaagcgagatgaagcgctgatcctgcccatcaactcctccctgagcgtcacgctgcaccaggaccaggtgattgtgctctggtggctggaatggggtgacttctcatgggaccatagccgggCCTGTGTCCTCCTAaTTCCCGTTGACCATCCAATACGCGTTAACCCTTGTCTCCTCATCCACACACAGACCcaaagccacggggttgGTTTTACGTCCGATTCCTTTACTCAAGAGGGACCAGGTGTCCATGGTTCTGTGGTGAGACAGTGCTCACCCTGACACAGCGCAGGTCAGGCCAGTATGGCTACCC
This mutation is a 428 bp deletion beginning at Chromosome 8 position 122,440,127 bp and ending after 122,440,554 bp (GRCm38/mm10). In addition, there are 2 smaller intronic deletions before the 428 bp deletion, neither of which should alter the results of the exon deletion: a 16 bp deletion (CAACCCCGTGGCTTTG) and a single bp (T) deletion that are 71 bp and 15 bp before the 428 bp deletion, respectively.
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42360 | CCA GGA CCA GGT GAT TGT G | Wild type Forward | A | |||
| 42361 | TGT GTG TGG ATG AGG AGA CA | Common | A | |||
| 42362 | TCT GGG AGA TTT GAC TGT GCT | Mutant Forward | A | |||
| 42363 | Fluorophore-1 | ACT TCT CAT GGG ACC ATA GCC | Quencher-1 | WT Probe | ||
| 42364 | Fluorophore-2 | CCA CCT GTG TCC TCC TAT TCC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42360 | 0.40 uM |
| 42361 | 0.40 uM |
| 42362 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.