For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:4084768+4084882 115bp GGCCTTGGGTATGTTGTGAG CGATCCTGCAAAGTACACAGA
Mut= 109 bp
Wt= 115 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTCCTGGGGTCCCATGGCAGGTCACAGGGAAAGGGATCCCTAAGACACCCAGACAGATGACCAGGACCGGGCAGAATCAGGCACAGGCCTTGGGTATGTTGTGAGGTGGGCTGGATGAGAAACCTCAAGACACAGAAAGAGGGTgccgaggtgtgggcaggccaaggaactcctaactatctgtgtactttgcaggatcgagagctgagaccagaagagatcgaaggtaatgggttcagggagtgggtagttgaggtggagtgtggggtgggggttacaagaagaggtttggggctagggcctctgcaaggtccaggaggagcgagaaggacatggggtctgggcagggagggctggcaaaacctcccttctttgccaaccccttggtctcagtgaccacactggtcaaggactgcttttatatttgtccatctggctgacacttcctggctgtccactgtgggcctggccccttgctaaccctgctaaccaggtagattaagggccccatcttctggagatagctacagctgcagctgcatagagcactcttaggaaaaccaatgactgggctgactaggaagaaatgggcagggaagtcttcctggtagcttttctgtctcttctcccctcccaccttctcttccttctctttttaatcacctagaacagagatgggcacatgacagatgcttcttaagcattggatgagagaacaaaattttaacactacacatgcaaaggctcttgggtaacaactaggaactgaggtttaacaacaagaagggactggagcaaagggaaaagatggaccggccccaaccggcagccaggaaggggcgctcagaaagggactaacctcactctgtccggcagagctgcagatcgccttccaggagtttgaccgagaccgggacggctacatcggctaccgggagctgggtgcctgcatgcggacactgggctacatgcccacggagatggagctcattgagatatcacaacagatcagtatgtgcttcagacccaacagagcctcatgccccagccctggcccagccctgaggtagacgtgtgcgctgttccaaacgcccaggaTATAAAGTTGTTATTAAAGGGAGAGCAGGGAGGATGGCTCCAGTAAAGAGACTGAAGCTCAGAGAGGTGAAGTATTGTCTAGAGTCACACAGCAGGGGCTCAGAGAAACCAAGAAACTGTGACTTAAGATCCTAGTA
This mutation is a 954 bp deletion beginning at Chromosome 19 position 4,084,827 bp and ending after 4,085,780 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42297 | GGC CTT GGG TAT GTT GTG AG | Common | A | |||
| 42298 | CGA TCC TGC AAA GTA CAC AGA | Wild type Reverse | A | |||
| 42299 | CTC TTT ACT GGA GCC ATC CTC | Mutant Reverse | A | |||
| 42300 | Fluorophore-1 | CAG GCC AAG GAA CTC CTA ACT | Quencher-1 | WT Probe | ||
| 42301 | Fluorophore-2 | AGA GGG TTA TAA AGT TGT TAT TAA AGG GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42297 | 0.40 uM |
| 42298 | 0.40 uM |
| 42299 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.