For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:127589872+127589968 97bp CAGACCCAGGGACATCAGA CCCCACATCAAAGTCACCTC
Mut= 100 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case; and insertions with carrots ^g^ (CAT and CACATCA insertion):
TACACAAACCGGGTGGTGAGGGTGGGTGTGCCAACGGCGTGAATGTGATCAGAGAACAACTTTACGGAGTCCCTTCTGGCCTTTTACTTATGCGCACATATGTTCCCGTAAGTCCTGTGT^gatgtgtctgagttggaaacaggtaggggcaggaacggaatgtgaagctctcatgactagcatattctctttgcaagtgtctgagccttgctatatacctctcccctttcagtctaatccttgtcctattgtgtgtcagtgatggttcagggtcctgcccgacactctgcctcttcccttctggtaggaggagatggattccaaggtactgcagttcaagaacaagaagctggcggagcggttggagcagcggcaagcctgcgaggatgagctccgggagagaattgagaaattggagaagaggcaggccactgatgatgccacactcctcatcgtcaaccgctactgggcccaggtggatgcctgaagagcgagcgtcctactgggagaagccctgaggcattcctaacctcttgttctttcttctttcagctggatgaaactgtagaagccctcctccagtgctacgagaaccagagggaactgtcttcagggacagaggtgcctgggtgccaagagggcctgacccgtgatgtgatccctcgaccagacccagggacatcagatctgaggggtaggaccagggccctggg^GAGCTTATGTTCTCAGAAAGGTTTTGAGGAGGAGGTGACTTTGATGTGGGGCTACC^gaaatgcccggcacttggg^AAGCAGAAGTTGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCTTCAAACTCAGAAATTTGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGTGC
This mutation is a 593 bp deletion beginning at Chromosome 7 position 127,589,325 bp and ending after 127,589,917 bp (GRCm38/mm10). There is a 3 bp (TAC) retention 95 bp (7:127589325-127589419) after the beginning of the 593 bp deletion followed by 495 bp of additional deleted sequence. In addition, 56 bp after the deletion there is a 7 bp insertion (CACATCA) and a 19 bp deletion (GAAATGCCCGGCACTTGGG), that will not alter the results of the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40562 | CAG ACC CAG GGA CAT CAG A | Wild type Forward | A | |||
| 40563 | CCC CAC ATC AAA GTC ACC TC | Common | A | |||
| 40564 | CCT TCT GGC CTT TTA CTT ATG C | Mutant Forward | A | |||
| 40565 | Fluorophore-1 | TCT GAG GGG TAG GAC CAG G | Quencher-1 | WT Probe | ||
| 42296 | Fluorophore-2 | AGT CCT GTG TTA CGA GCT TAT GTT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40562 | 0.40 uM |
| 40563 | 0.40 uM |
| 40564 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.