For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:57995327+57995463 137bp CGGATCATACAGGTGAGTACTGGT GTGGCCAGAAAGAAGAGCTG
Mut= 131 bp
Wt= 137 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TCCTTTCTGGGGCCCCACCCTCCTGAGCTGATTACCTCCAAAGCCCAGCCTCCCAGAACCACTGCACCAGAGACTGTGTCTCAACATAGAATTGGGGGTGCATGTTCAGCCGTAGCGCGTGTTTATCAGTGAATACCCAGttagtaagtgacgccctcactttgcgtccccagaacatctccatcaggagtgtggaaggggaggtgtattgtgccaagtcaggcaggaaatttgccggccaaatccaagagaagttcatcatctcagactggaggtttgtcttatccggatcatacaggtgagtactggtttcatctgctgtccaggcttccgggcagtgatgggctaagtggggtaccagcTGGATGATGGCTGCTCCCACCCCACCCCCCCCCAGAGCTCCCAGCTCTTCTTTCTGGCCACAGCTAGAGCTCACCAAATAAACGAAGCCAGAAGTGAGAAATGTGGCCCCTTCCTGACACTGAAATTGGACAGAGACTTCTTTCTACTCTCTCCGGC
This mutation is a 222 bp deletion beginning at Chromosome 15 position 57,995,181 bp and ending after 57,995,402 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42291 | CGG ATC ATA CAG GTG AGT ACT GGT | Wild type Forward | A | |||
| 42292 | GTG GCC AGA AAG AAG AGC TG | Common | A | |||
| 42293 | AGA CTG TGT CTC AAC ATA GAA TTG G | Mutant Forward | A | |||
| 42294 | Fluorophore-1 | CGG GCA GTG ATG GGC | Quencher-1 | WT Probe | ||
| 42295 | Fluorophore-2 | AAT ACC CAG TGG ATG ATG GCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42291 | 0.40 uM |
| 42292 | 0.40 uM |
| 42293 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.