For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:100702981-100703100 120bp GGCCATTGATCACATCCTACA AGCGGAAGAGACGAGCATAG
Mut= 121 bp
Wt= 120 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTGATGGCTCGGAGCCACGACCTGCTCATCTGTACGGCAGAGTTGTTACAGTTGGCACTCAACAGCTCTGAGGAGGATGAACACGTAGAGCTCAGAGGTGAGGGGGAAAGCCGTGACCTGctcacaggacgtgctcctgggcaagcaagcctccttcctctagcccagcctcgctttcattcctacctgctccctgtctgggacccagcccaaagtagggaagggaagaggaaaacttcagagaaaaatgagggcttcacaaaagtgctatgagaaagaagcagcagcagcagccgtccactgtctctcatgtgcccccagaattctcgctgattgtggtggacgagtgtcaccacacccacaaggacaccgtctacaacaccatcttgagccggtacctagaacagaagctgaagaaggcagagcccctcccccaggtcctgggtctcacagcctccccaggcactggaggggccaccaagctccaaggggccattgatcacatcctacaggtcagctgagcccctcccaccatagatctttgcttgtcttgcctcccagtCCTACCAAATATACTCTTCATACTATGGCTATGCTCGTCTCTTCCGCTACCTTGAGCATATGAGGCTTGTGGGACCCTTTGAACTTACTATTCCTTTTGCCTGGAAATGCC
This mutation is a 442 bp deletion beginning at Chromosome 11 position 100,703,029 bp and ending after 100,703,470 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42134 | GGC CAT TGA TCA CAT CCT ACA | Wild type Forward | A | |||
| 42135 | AGC GGA AGA GAC GAG CAT AG | Common | A | |||
| 42136 | ACA GTT GGC ACT CAA CAG CTC | Mutant Forward | A | |||
| 42137 | Fluorophore-1 | AGC CCC TCC CAC CAT AGA | Quencher-1 | WT Probe | ||
| 42138 | Fluorophore-2 | CGT GAC CTG CCT ACC AAA TAT AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42134 | 0.40 uM |
| 42135 | 0.40 uM |
| 42136 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.