For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:172632559-172632661 103bp CGACCAATTTGTGAAGATCG GCCCACTCATTTCCTTCCAG
Mut= 91 bp
Wt= 103 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TACGTGGCCCGCTAGGGCAAGTGCTGAGCGGGGACGGAATCCAGCCCCAGAGGGGGGGTGACCCAATCTCCCGGCAGAGTAGGAAAGGCCAGCCTCGCCCTGAGTAAACTCCCCCCACGATGGgcgtgcaaccccccaacttctcctgggtgcttccgggacggctggccggactggcgttgccccggctgcccgcgcactaccagttcctgctggaccagggtgtgcggcacctggtgtccctgacggagcgcggaccccctcacagtgacagctgtcccggcctcacgctgcaccgaatgcgcatccctgacttttgcccgccgtccccggaacagatcgaccaatttgtgaagatcgtggacgaggccaatgcccggggagagGTCAGCACGCTCGTGAGCCAGAGCGAGAGGGCGGGGCCTGGAAGGAAATGAGTGGGCGGGGCCGGAGCTGGAGTCCGAAAAGAGTGGGAGAGCCTGGGGTTGGGGGCGGGGGTGACAGGGCTAAGTGGGGTGGGAG
This mutation is a 263 bp deletion beginning at Chromosome 1 position 172,632,616 bp and ending after 172,632,878 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42007 | CGA CCA ATT TGT GAA GAT CG | Wild type Forward | A | |||
| 42008 | GCC CAC TCA TTT CCT TCC AG | Common | A | |||
| 42009 | CAG CCT CGC CCT GAG TAA AC | Mutant Forward | A | |||
| 42010 | Fluorophore-1 | ACG AGG CCA ATG CCC | Quencher-1 | WT Probe | ||
| 42011 | Fluorophore-2 | CGA TGG GTC AGC ACG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 42007 | 0.40 uM |
| 42008 | 0.40 uM |
| 42009 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.