For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:30107303-30107406 104bp ACTCTCCTCGCACAGTTGCT CAGAGGTAGGATGGCCACAG
Mut= 116 bp
Wt= 104 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AACAGAAAGAGGAGCTTATTCTTGCTTGTCAGTGAAATGTGTCTGTGGTATAATGGCAGGGGACCTTTCAAAGGTACTGGCAGTGGTGGCAGCTCCCAGTCCATGTTCTACAGTACGCCCTCCCACCCTTCcatcaagaagtgagagcagggaatgcagctcaagtggtacaaagctctgactttgatcaaagcaggcagagaagcatgtgcctgtatcccagcacttgagaggtggggtaggaggaccaggggttgaaggtcaggctcagctccacagtgggttgggcagggacaggatgagattagaagccgttgtttctctatgggtggagttcctggtccatgggggagcccaggctaggtccagtcaggtggctagctctgacatgctctttccccagcaccgagccatccaagagcagcatcatgcccttccgggctctgaagaggccactgcagttccttgggctctttgagacctcattgtgtcgtcttacgcacattccagcctacaaagtaagaggtggagttgggaggaggaagtggccaggtaccgcatagcactgagtctggggtcccattacctgggttgtcctgacatgttctgtcactaggtgagtggtgacaaaaatgaagagcaggtgctgaacgccatcgaggcctacacagagcaccggcccgagatcacatccagggccatcaacctgctgtttgacattgcacgcattgaacgctgcaaccagcttctgcgggccctgaaggtcagctcagaacccaaggccctcaggctcccagatactgctgccctccttctctgtccttctgcacccagccctgatcccaggggaacaggtagtcttgccttgcaaacctccgccctttggcagtgctggcctcactgccagcctgtccaggccctgccctagtttctgatctcacatctccccaggagagcaagtctaaggtcagcctttccccagagaagacacggtgacttaaagagcccaggctgtctttgcctgcctctggcagtgccccagctccagccccttccctgtgttcacacagctggtcatcacagccctcaagtgtcacaagtatgacaaaaacattcaagtgaccggcagtgctgccctcttctacctgaccaactccgagtaccgctcggagcagagcgtcaagttgcggcggcaggtcatccaggtggtgctgaatggcatggagtcctaccaggaggtgacggtgagcccctgcctgctgcggcctgcatgcttaggcccagtatcccttcctgctccccaggctccccaggcttagggggcctttgccaactctcctcgcacagttgctgtcccagaaacctgcccctggcacacagggaccgcagaagctggcttcAACTGCAGTCCCCTGCCTGTGGCCATCCTACCTCTGCCCTCTGTGTTCCTGATTTGCCATTTTCTCTGCCCCTCTCTCCCTATCATTGTTGGGGGTGGGGGAGTT
This mutation is a 1269 bp deletion beginning at Chromosome 2 position 30,108,607 bp and ending after 30,108,607 bp (GRCm38/mm10).
Designed assuming this was supposed to be from 30,107,338 bp and ending after 30,108,607 bp. - DSW 7/27/18
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41674 | ACT CTC CTC GCA CAG TTG CT | Wild type Forward | A | |||
| 41675 | CAG AGG TAG GAT GGC CAC AG | Common | A | |||
| 41676 | AAT GGC AGG GGA CCT TTC | Mutant Forward | A | |||
| 41677 | Fluorophore-1 | CCC AGA AAC CTG CCC C | Quencher-1 | WT Probe | ||
| 41678 | Fluorophore-2 | CCA CCC TTC AAC TGC AGT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41674 | 0.40 uM |
| 41675 | 0.40 uM |
| 41676 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.