For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:117549217+117549332 116bp CCTGCCGTCTGCTATCAAG TGAACACAGCACAGCACATC
Mut= 116 bp
Wt= 116 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATAGATTTACTTGCCCTTAGGCAGTGTGTGCATGTATAAAATGTATGCAATATATATAAAATATACACAATGTAGACAGCACTGGTCCATATCGTCTCCTTTATGCTTTGATCCTGAGGATTCCAGCTCTACTGTATTCCAACCATTATAGCAGCACCTCCTGCTGCCatttgaacagaaccccagagggaaattttccccagacaggagagtggaggaggggatcttggagaattgcagtcactgtcctggtcactgtgagcgtggagaggctgtcttgtgggagcagagtgggaagctagtactcagagaaaagcatttccacagtccgagccaatgagagagaagaatggcagtcttggctcgggcttctccacctgccaccctctcggggccagcctgcttaccagcatggctcagtgacaattttctgtttctctaatcctccaggatggctacttctctcaccgtcccaaagagaaagttcggaccgacagcaacaatgagaactcagtccccaaggactttgagaatgtggataacagcaacttcgcccccaggacccagaagcagaaacaccagccagagctggcaaagaagccccccagcaggcagaaagagcatttgcagagaaagctggatgcccaggacaaacgacagggccagtcagtcctggggaaaggccccaaggaggtgctgcctcctcgggagaaagccacaggcaacagtagccaagggaaggatctctcaagacacagccatgccaggaagagtggtggtggtgggtcccccgaaaccaagtctgaccaggcccccaagtgtgatatctctggcaaggaggccatctcagcactgacccgcgctaagtccaagcattgtcgccaggagattgcagaaacctactgtcgccacaagctggggctgctgatgccagagaaggtggctcgattctgtcccctagaaggtaggtctctttctcctgtccctggccccatctctctgccttctcaggccctctgaatatagccacactgcacctcaaaccctgaccacaagatctggtttgtctgggaactctgaactcctgccgtctgctatcaagaaagtttgacaaaatcatgacatgtgatagtatcatatgacctgttccctttagcagATATGATCTCGGTGTCTGCAGATGTGCTGTGCTGTGTTCATAGCTATCTGGAATTTACAGGCTACAGAAATTAGAAAAAAATTAGACTCTGTCAGACGTAGGCTTTTTACGTATGCAATATTGTACAGCCCCAACATTACATA
This mutation is a 991 bp deletion beginning at Chromosome 7 position 117,548,302 bp and ending after 117,549,292 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41655 | CCT GCC GTC TGC TAT CAA G | Wild type Forward | A | |||
| 41656 | TGA ACA CAG CAC AGC ACA TC | Common | A | |||
| 41657 | CGT CTC CTT TAT GCT TTG ATC C | Mutant Forward | A | |||
| 41658 | Fluorophore-1 | CAT ATG ACC TGT TCC CTT TAG CA | Quencher-1 | WT Probe | ||
| 41659 | Fluorophore-2 | CTG CCA TAT GAT CTC GGT GTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41655 | 0.40 uM |
| 41656 | 0.40 uM |
| 41657 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.