For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:25858923-25859004 82bp GATGGGTTTGTTCCTGTTGC AGTCTTCTGGCTGCAGTGGT
Mut= 82 bp
Wt= 82 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
GGATGAGAAGAGCTGTTCCCCCCCAGAAGCAGGTGGGCTGTGGTTCGACAGGGTGCACAGGGCTTGGTGGGAACAGTTTTGGGGCATCCTGAATGAGGATCAGTAGCATGGAGACTACACATGGTATGTGCCTGGGGCAGCCTGGAAATAggcccagagaagGGCGGAGCTGGTGGCCCTctgaggtcctagaatcgtaaggtccatgcaagtggcatctggtctccaagctttcgtgttggagagactctgccagagtttaggatagaatggtggcagcgtttatggaatagcatctgtagaatggtgaggggaacctcctgttcctccctgcaccttggctgacatcctcatgggtcctcttgctgctcctccctggctctttgctccattgtagtcttcctaggtcgtatgtcacggcacctgcctcatccaggggtcttgggcaaacctttgctgagcagtaagtcccctgtggcccaggcatgtagctctgcattggtgagtgcgcttgggaaagggctggggaccggtgcccctaagggtgctgatggcacatgttccattacagccatgccaggtcctttcagcatctagtcgccttccagaggtcagccggacctacaggtatcgagaagtctccagtgtaagtgcctccagcatccagagccaacgtccttcagttcgcgatgaggttcccgatgcacacacggtgtccggcgagagacacgttcttgctgacagatcatctggcgtgcccatggcccttgaggacattggttcctgtagggtgagtgcccatctgaaggcattgggcattagtgagataacaggctggctaacctgagcctcctgagatgcatccagagtggatgggcctctagagatgggtttgttcctgttgccaattctgtcaaaggacaggacctggggtttctaaagactttaccactgcagccagaagactgcttctagcaggagttctttgtacctccccaccttttatttgagaggcagcacaagtggggcattcgcaggggatagagtgacttcccccagtctcattttgcattttcctatttcagcttttcctcccagacccagtcctgaggctcaagggcgtcatcggttttgggggtcacagcacccaatgggtgaggttcccaggccagttttgattgggtgggacgagtgagttttagggaaggaaagattcctagttctgtctcgggcactttctttcctcaagaaaccctgccctgcccacctcttattcctgagggctaatgtgagtctttaggtcatgggtgccctctgttcacttggtaaggtctgctgggctaaagggctcccaaagacccaagagcTCTGagatacggatgtgtgtgtgtgtgtgtaaaattttttaagattattttatggggctggagaggtGGCTCACTGGTTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCAGCAACCACATGGTGGCTCACAACTATCTGTAATGAGATCTGATGCCCTCTTCTGGGGTGTCTGAAGACAGCTACAGTATACTTACATATAATAAATACATCTTTAAAAAAAAA
This mutation is a 1250 bp deletion beginning at Chromosome 17 position 25,858,456 bp for 1187 bp followed by an endogenous 4 bp retention (TCTG) then an additional 63 bp deletion ending after 25,859,709 bp (GRCm38/mm10). In Addition, eighteen bp before the exon deletions there is an 11 bp deletion that will not alter the results of the exon deletions.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41649 | GAT GGG TTT GTT CCT GTT GC | Wild type Forward | A | |||
| 41650 | AGT CTT CTG GCT GCA GTG GT | Wild type Reverse | A | |||
| 41651 | GAA ATA GGC GGA GCT GGT G | Mutant Forward | A | |||
| 41652 | GGA TTT GAA CTC AGG ACC TCT G | Mutant Reverse | A | |||
| 41653 | Fluorophore-1 | AGG ACA GGA CCT GGG GTT T | Quencher-1 | WT Probe | ||
| 41654 | Fluorophore-2 | CCT TCT GGG CTC ACT GGT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41649 | 0.40 uM |
| 41650 | 0.40 uM |
| 41651 | 0.40 uM |
| 41652 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.