For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:100499929-100500066 138bp GCCACAGGGACCAAGAAGT CCGAGGGTGGATACACTGA
Mut= 152 bp
Wt= 138 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (A insertion):
CTTCTCTTGCAAATAGACAGCATTGGACTTTATGTGTATTTCACAAGATCATCATATGTTTTACCATTACAGGAGAATTTCTTTACTCCCTTCTGATCTTAAATTTCCAAATTAATATGTAACCATCTTGGAGTCCA^taactatgtggcaaagaaatgacttagcgcttgagccaacactgctggaatgttccctgctaaagagcactctctcacatagacacaatcttgggttctaaaggttccagaagagcctcgccagaaacccggaagcttagtgcatgtggggcgtgaggtcctcggggcgtgaggtgctcagggctttcctgcacacagaccgtttcttattcatttatcgtctcacttggttctgcagatgatatggctgaacttctccttggggagtcgaaactggaacagcacttgaaggagaagcccctgcggcagggagccagtccccggggccccagaccccagctgactgaagtgcgcaagcatctgaccgctgccctggaccgagggaacctcaaggtactgtgtgccacagggaccaagaagtgatggtagtgggtactgccatcatctcctagggacagtgtggtgagcaaggtgtgtttggcgcacacgtgtcttctttagcaggcacacgccctgcct^GATCAGTGTATCCACCCTCGGCTGGCTGGCCTGTGGGGCTCCCAGCCTAGTAGGAGTCTCTGATGGGAGTCTGCAATAACACATTCAACAGAACGAGGGGTTCATTTCCCCCCAGGCACTT
This mutation is a 519 bp deletion beginning at Chromosome 12 position 100,499,950 bp and ending after 100,500,468 bp (GRCm38/mm10). There is also a single bp insertion (A) at the deletion site that will not alter the results of the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41640 | GCC ACA GGG ACC AAG AAG T | Wild type Forward | A | |||
| 41641 | CCG AGG GTG GAT ACA CTG A | Common | A | |||
| 41642 | TGC AAA TAG ACA GCA TTG GA | Mutant Forward | A | |||
| 41643 | Fluorophore-1 | TAG CAG GCA CAC GCC C | Quencher-1 | WT Probe | ||
| 41644 | Fluorophore-2 | TGT AAC CAT CTT GGA GTC CAA GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41640 | 0.40 uM |
| 41641 | 0.40 uM |
| 41642 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.