For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:121040534-121040657 124bp TGGACATAGGGGTGAATGTG AAGGACAAGTCGATGGCTGT
Mut= 134 bp
Wt= 124 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case; and insertion with carrots ^g^ (GATC insertion):
TAATCTACCCTTTGGCAGCAACCTTAGAGACTTCCTAAGGGTCCCTGTCTTGATAAAAGATGAGATGTGATTTTCATGCTGTTGGTTTAGATGATGCCCCA^tttaa^GTTTTGCCGATCTACGGGTTCTCTAAGCTGCTTGAGGTAGACATGCCAGgggttcagtcttcccagcccaccaagcatgagctcgtccttcaagcctctgcaaggactcagtggtccgagtcaggcttccagcgtcttggtcctggagtttggacataggggtgaatgtgggacttgagaggcgtggccttggccctgagagcacctgtatctttcagtgtctcatcattggagctggcccctgtgggctgcgcacagccatcgacttgtccttgttgggagccaaggtggttgttattgaaaagcgagatgccttctcccgcaacaatgtcttacatctctggcccttcaccatacacgatctccgaggcctgggtgccaagaaattctacggcaagttctgtgccggagccatcgaccatatcagtgagtaacactggctcttcttgctttccttcttcggtgggttaagtgaggacttcctcctcacccagcatttgcacccgccaccctggtctataacctgccttcttaaccaagtggggctcttgtacaaaaggagttaaagtttgctttaaagatccttaattgggggccaggtttggtggtgcgcacttttaatcccagcactcagacagattgtgagttcaagaccagcctgttctacagagagaattctaggacagccagTACTACAACAGAGAAACCATGTCTCCACAAATTTTTGGTTGGGTCTTGGACTCTTCCTGAGTACCCATGGTATATGCAGTTCAGTTGAAGGGAAGGGTGGGCATTGAGAATAAGGTAGACAGGTTGGATTT
This mutation is a 641 bp deletion beginning at Chromosome 6 position 121,040,118 bp and ending after 121,040,758 bp (GRCm38/mm10). In addition, there is a 4 bp insertion (GATC) and a 5 bp deletion (TTTAA) 59 bp before the start of the exon deletion, that will not alter the results of the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41617 | TGG ACA TAG GGG TGA ATG TG | Wild type Forward | A | |||
| 41618 | AAG GAC AAG TCG ATG GCT GT | Wild type Reverse | A | |||
| 41619 | AGC TGC TTG AGG TAG ACA TGC | Mutant Forward | A | |||
| 41620 | TTC TCA ATG CCC ACC CTT C | Mutant Reverse | A | |||
| 41621 | Fluorophore-1 | ACT TGA GAG GCG TGG CC | Quencher-1 | WT Probe | ||
| 41622 | Fluorophore-2 | CAG TAC TAC AAC AGA GAA ACC ATG TCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41617 | 0.40 uM |
| 41618 | 0.40 uM |
| 41619 | 0.40 uM |
| 41620 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.