For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:55084911-55085025 115bp TCTGGGATTTGGCGATTAAC CACTGATCATTTGCCAGGAG
Mut= 117 bp
Wt= 115 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case; and insertions with carrots ^g^ (G at first insertion, GTCTC at second):
TCAGAAAACAAAATAAACCTAGGTCATAGCCAAAACTCAAGTGCAAATGATGTGAAGAGTGTTCTGGGATTTGGCGATTAACATCTGTGCTTTCTTGTTTTATGGGTGGCATCTGTTA^gtaccagggaattcctgttgtgcttcattcaatgttggactcctggcaaatgatcagtgctcattttttatagacctaagatggttgattaacgtggctttgagattcatgttgcaggatggttaaaaatgacaaatttgagggttatcattgagggttgctttttttttccctgtcgctgtagggaagaactgtgattattgaacagagttggggaagtcccaaagtaacaaaagatggggtcactgttgcaaagtcaattgatttaaaggataaatacaaaaatattggagctaaacttgttcaggacgttgccaataacacaaacgaagaggctggggatggcaccaccactgccactgttctggcacgatctattgccaaggagggctttgagaagatcagcaaaggggctaatccagtggaaatccggagaggtaagagtatatcattgatcttatcctgtaaa^GAATTCTGTTGTCTTTATCTTTGTCCTTT^ttat^TACATTCGTTGTAGAGTTTGTGAGTGTTCATTCTTGGTGGAATTGCCCTTTCCTTACTTATGTGGGTTTCCAA
This mutation is a 469 bp deletion beginning at Chromosome 1 position 55,084,501 bp and ending after 55,084,969 bp (GRCm38/mm10). In addition, there is a single bp insertion (G) at the deletion site as well as an indel with a 5 bp insert (GTCTC) and 4 bp deletion (TTAT) 29 bp after the 469 bp deletion that will not alter the results of the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41612 | TCT GGG ATT TGG CGA TTA AC | Common | A | |||
| 41613 | CAC TGA TCA TTT GCC AGG AG | Wild type Reverse | A | |||
| 41614 | CAC TCA CAA ACT CTA CAA CGA ATG | Mutant Reverse | A | |||
| 41615 | Fluorophore-1 | CCT GTT GTG CTT CAT TCA ATG T | Quencher-1 | WT Probe | ||
| 41616 | Fluorophore-2 | TGG CAT CTG TTA GGA ATT CTG TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41612 | 0.40 uM |
| 41613 | 0.40 uM |
| 41614 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.