For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:62427751-62427839 89bp AGACTCCCAAGCCACAGTCA GACAGGCTGGGTACAGAGGA
Mut= 82 bp
Wt= 89 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CACACGTCACAGCATAGACACACTATATAAACATGCTACAGTGCACACGTGCCACACACACACTCACACAGCACACACAGCACACAAATCCCATGTACCATACAGACACTCACTGTGATCACACATACACACATATCACGTATATACCATCCCATATCCACCCctgcccctagtagagctaccaaggcacagggttagctctctcctacagtgccttgggcctaggtctgctggaccctgccctctactctcgttgcttctctgctaccctcagggggatggaaacatccggtactatgagatcagcacggagaagccctacctgagctacctcatggagttccgctccccagccccacagaaaggcctaggtaaggacctggaagctgatgcaggctgctctgtgcagagcaggagatggtgtttattgtcttgtgcatacacaggatcccctttacacaatagtcagactcccaagccacagtcagcaggcagatgggaatgggacccacacgtgccacCTTCGGCAGGCCAGCTCCTCTGTACCCAGCCTGTCACTCATGGCACCAGCTTGGCTATCTCTGTCAGCAGCAGCCTGCAGGGTATGGGCTCTGGCTTCCTCCTCAGCTGTAGATGCAGAGACTCACTCCACAGTGGGGTTCACA
This mutation is a 358 bp deletion beginning at Chromosome 9 position 62,427,786 bp and ending after 62,428,143 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41588 | AGA CTC CCA AGC CAC AGT CA | Wild type Forward | A | |||
| 41589 | GAC AGG CTG GGT ACA GAG GA | Common | A | |||
| 41590 | GAT CAC ACA TAC ACA CAT ATC ACG | Mutant Forward | A | |||
| 41591 | Fluorophore-1 | AGG CAG ATG GGA ATG GG | Quencher-1 | WT Probe | ||
| 41592 | Fluorophore-2 | ATC CAC CCC TTC GGC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41588 | 0.40 uM |
| 41589 | 0.40 uM |
| 41590 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.