For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:33260679-33260761 83bp GGAGATTGGGCCCCTTTAG TGGCAAAAGGAAAGACCTGA
Mut= 85 bp
Wt= 83 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TTCTCGTGGCACGTCCGCCTGAGTCGCATGGCAATTGATAGCATATTTCAGCATGAGGCACTGGGGAGAAGAGACTGGCTAGGGCTTTGGAGTGACGCTCCTGGGGACactctcTGAGCCCTGTGCTGTATTTgccctcacagagatctatgttgggtgtgaaatgaaggagctagtgagcatcccgtggccagtggacgaggtggctctgaggctgactcctgggagattgggcccctttagcacctgtacttctatccagggtttgatagGTTGTGGgcatacattcaggtctttccttttgccatttgtcatagcccctggcctgtcagcttttctgattgattttttcccctccagataaatttcttttcattccagcttttgaatcgaaaagacaagactacttttgagaaacttgactacctgatgtccaaagaagacaactacaagcgaacccgggactacatccgaagtctgaagatggtgcccagcattccctatctaggtatgagtctcagttattttattattaactttccaggcaacataacatgctcagggccaaataagatgtttttacagtttctagttgagatgtttccaggaagcagcagggatcatggataaagaggtggtttggttggctccttggttggagaagGCTGTTGATGGTTCCCAGGATAGGAACACTAGTGaggtgGAAACAAGGCAACTCTGTCTTATGTACCTGGACTCTGAGGGCCCGGGCTACCGAGCTGTGAGGGCTCCAGGCATCCAGGCTGCAGCCCAGATAGGTCATGATGTTGGTAGGTCATGCTGTCT
This mutation is a 524 bp deletion beginning at Chromosome 2 position 33,260,322 bp for 139 bp then a 7 bp (GTTGTGG) endogenous retention followed by an additional 385 bp deletion ending after 33,260,852 bp (GRCm38/mm10). In addition, there is a 6 bp deletion (ACTCTC) 19 bp before the 524 bp deletion as well as a 5 bp deletion (GTGGAG) 31 bp after the 524 bp deletion, neither of which are expected to alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41338 | GGA GAT TGG GCC CCT TTA G | Wild type Forward | A | |||
| 41339 | TGG CAA AAG GAA AGA CCT GA | Wild type Reverse | A | |||
| 41340 | ACT GGC TAG GGC TTT GGA GT | Mutant Forward | A | |||
| 41341 | CCT ATC CTG GGA ACC ATC AA | Mutant Reverse | A | |||
| 41342 | Fluorophore-1 | TTT GAT AGG TTG TGG GCA TAC A | Quencher-1 | WT Probe | ||
| 41343 | Fluorophore-2 | TGC TGT ATT TGT TGT GGG CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41338 | 0.40 uM |
| 41339 | 0.40 uM |
| 41340 | 0.40 uM |
| 41341 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.