For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:144510166-144510252 87bp AGCTCTGTGGGTATGCAAGG GTCACATCACTGGGCACCTC
Mut= 104 bp
Wt= 87 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (TGTCTGCTTTGTTACAGAACCCAGTGCTACTAGATTGCCCCCTGTGGCTGGATCT insertion):
ATCTCTGCAACCCTAGGTCCTTGGGTGATCTGTTTGAGACTAATAGCATGGGTTTCTTGTAAGAGACAGGGCCAGCTGGGATCTCTGTGTGGGTTGGGGTGGAAGATAATAAGGACTGGCAGCCTGTGGGCTAGGACAGGTGGGCCATTTATACAGTTTTTACACCCTGGCCTTGCCC^ccttttaacttgtctatcaccaggagtactgcttttcatttactagggcatccatcgatttggagacccaagttctgcttactctaggactcaggaagtgttctcagaattgaaacgcatcttataggggccgagtccatgtgagagagttgccatggaagctgtttattgttttctaggaccaacttgtcgtgactattgaagccctgaaggctgagctggagcagatgagactgagaggtccttcactccatcatgggtatggcggtcacagatggactaggtttcagctctgtgggtatgcaagggcttgctgctgtctctgcgggc^GTGGGAAGAGGCCTCTGTGCTGACTGAGGTGCCCAGTGATGTGACAGAAGAGAGAACATAATGGGAGCAGAAGGACAGGCCTCATAGAAGAGTCCCACTGCAGGAGGGAGTGCCATGGGCAGCTGCTCAGAGTCCATTTCATAGCTTCGGT
This mutation is a 330 bp deletion beginning at Chromosome 7 position 144,510,211 bp and ending after 144,510,540 bp (GRCm38/mm10). In addition, a 55 bp sequence corresponding to Chr 7:144512416-144512470, from the upstream intron between exons 11 and 12, and inserted into the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41326 | AGC TCT GTG GGT ATG CAA GG | Wild type Forward | A | |||
| 41327 | GTC ACA TCA CTG GGC ACC TC | Common | A | |||
| 41328 | GCC CTG TCT GCT TTG TTA CAG | Mutant Forward | A | |||
| 41329 | Fluorophore-1 | CTT GCT GCT GTC TCT GCG | Quencher-1 | WT Probe | ||
| 41330 | Fluorophore-2 | TGG CTG GAT CTG TGG GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41326 | 0.40 uM |
| 41327 | 0.40 uM |
| 41328 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.