For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:108070997-108071082 86bp TCATCCTGATGGAGGTAGCC TCAGGAATATGTCAGGGGTGT
Mut= 85 bp
Wt= 86 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (TCACCCTTCTCCTTGAACACTGGAGGATGCTTGGCTGAAGCTCCAGA insertion):
GATGATTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTATTAACGACCAAACCATCTCTCCAGCCCCAGAAATCACTTTTTCACTGAGGAAGGTTGAGACCTG^ctggtctggagcttcagccaagcatcctccagtgttcaaggagaagggtgacagggacttactgtttggctgagctcaagagcttgtgggtccccagcatctctcattccctaggaaaccgctaaacttccataacctgcctgagcacgtggaccagctgctacaggtggacagtgaagacaacgagagccagggtaggaggtgttctcaggggtggggtgggtgaggaatgtggtgtcaaagcctggagttctctgcacagctcatgtctccctgtgtctgtcagaccctctgccatccctgatttcacacatctcccttcccaggacaagttgaaggtcgacttggcccatctactgtggtcctagaccacacaggaggctttgaggggcttctccttgtggatgatgacctcctgggggtgagtggagatgtgtcttgggccccagctcagccccatcctctacgcttatcctgatggctacatgttcatcctgatggaggtagccatacacctatcttgacaccactccaag^CCATGGTGTCAGCCCTTAACACCCCTGACATATTCCTGACACCATGATACAGTCACTACCTCCAACCCTTTCAGCAAAGCCCAGAGTCCCATCATGTCTGTCCCAGAAGCTCTGGACATGGATACAGTTTCTCCTGCCTCAACCAGACACAGTGCAGTGTTGGCCATGACAG
This mutation is a 536 bp deletion beginning at Chromosome 9 position 108,071,036 bp and ending after 108,071,571 bp (GRCm38/mm10). In addition, there is a 47 bp inverted sequence from the deleted region Chr9:108071521-108071567 (TCACCC through TCCAGA) at the deletion site that is not predicted to alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41234 | TCA TCC TGA TGG AGG TAG CC | Wild type Forward | A | |||
| 41235 | TCA GGA ATA TGT CAG GGG TGT | Common | A | |||
| 41236 | CAC CCT TCT CCT TGA ACA CTG | Mutant Forward | A | |||
| 41237 | Fluorophore-1 | ACA CCT ATC TTG ACA CCA CTC CA | Quencher-1 | WT Probe | ||
| 41238 | Fluorophore-2 | AAG CTC CAG ACC ATG GTG TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41234 | 0.40 uM |
| 41235 | 0.40 uM |
| 41236 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.