For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:14119788-14119885 98bp CTGCAGATGAGAGGTGCTC CAGAAAGATTCTCTTATCCAGTGAG
Mut= 113 bp
Wt= 98 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case and insertions with carrots ^g^ (G insertion):
TTGTCGCGGCTGGACTCCCGGCAAAGGCGCCGCGGCTTTAGTGATGCCTGTCGGTGTTTAGCTGCCGGCCAAGGGACAGTCAGGGTTCTGTCCCTAGTAGTCGAGTCGAATCGGTGTCCTTTCCCTGACATGAGGACTCCTTTGGAACAGGAGCCGACCAGAGCAAACTGAGGATTCGATTCCCT^tccccttggccttagtcgcgatcagacctgctaagatcggctctcaagcaggctcccagcttcaaaccttagccgtgctacccaggcccatagttgggaggcgtctgctagctgaccttcggtggggtgggaaaagcgagcagaagctaacaggatacctcataatgcgtgatttgtggcttttagatatggctccttattatgaagccttgtgtaaatccctcgactggcagatggacgtggatctcctgagtaaaatgaagaaagcaaacgaagaagagttgaaacgtttggatgaggagctggaggatgcagagaagaatctgggagaaagtgaaattcgagatgcaatgatggcaaaagcagagtacctctgtcagataggtgacaaggtcagtgagatgccctgcccgctctgggtaggtgacagggtcagtgagatgccctgcccgctctgggtaggtgacagggtcagtgagatgccctgcccgctctgcagatgagaggtgctccctattttctggaggtacagaccaatgttgtacatc^AGTGCAAATGAGTAATATCTCACTGGATAAGAGAATCTTTCTGTTTTAACTGGAAGGATAATCATATTTACCTGTACTGAAGAGTCAGTACAGGAACAGTAGATACATGACAATGTTGCAGCACCCAATTCCCTGCTCTTAACAGAGCAAGGTGTGCGTTAGTCTTCCTT
This mutation is a 548 bp deletion beginning at Chromosome 14 position 14,119,831 bp and ending after 14,120,378 bp (GRCm38/mm10). In addition, there is a single bp (G) insertion at the deletion site that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41220 | CTG CAG ATG AGA GGT GCT C | Wild type Forward | A | |||
| 41221 | CAG AAA GAT TCT CTT ATC CAG TGA G | Common | A | |||
| 41222 | TCC TTT CCC TGA CAT GAG GAC | Mutant Forward | A | |||
| 41223 | Fluorophore-1 | CTG GAG GTA CAG ACC AAT GTT GTA | Quencher-1 | WT Probe | ||
| 41224 | Fluorophore-2 | TCG ATT CCC TGA GTG CAA A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41220 | 0.40 uM |
| 41221 | 0.40 uM |
| 41222 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.