For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:69094565-69094671 107bp CAAGCAGTGGTTCAGTCCAG CACTATGCCTGGCCAACAC
Mut= 92 bp
Wt= 107 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AAGGAAGGAAAAGGTTATGGTATAGAATTGAAAGTTAAAATCAAAGTAAGAACCAAAAACAAACTTGAGACTGATTTTTAACTTGTGAGCTTTGAAAACTGGCACAATGAGTAATTGAAAACTGAGGAGTAATATGAAAGTACATTTCTAAGTCAGgatgtcggactttcacactgaaatggttgggctatgtttttaaggctagaaaacatttcacatactagaggggagaaattgttggtagacgtttagatgatatgagacgtatggttttaaaaaaatcacttcttctttggtagtccttctttacagtttgaagctgcgtgggctttgacaaacattgcatctggaacgtctgaacaaacgcaagcagtggttcagtccagtaagttgttaattaacaaagttgtaattgttttccttcccattggtagaaaataaactaccagGCGTAGTGTTGGCCAGGCATAGTGGCTCATGCTTTTAATTCCAGTACTTGAGAGGCTTACATAGGAGGATCATGAGTTTGAGGCCTGCATGGGCTACGATACTGAGACCTCA
This mutation is a 293 bp deletion beginning at Chromosome 3 position 69,094,589 bp and ending after 69,094,881 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41184 | CAA GCA GTG GTT CAG TCC AG | Wild type Forward | A | |||
| 41185 | CAC TAT GCC TGG CCA ACA C | Common | A | |||
| 41190 | GCT TTG AAA ACT GGC ACA AT | Mutant Forward | A | |||
| 41191 | Fluorophore-1 | AAG TTG TAA TTG TTT TCC TTC CCA | Quencher-1 | WT Probe | ||
| 41192 | Fluorophore-2 | TGA AAG TAC ATT TCT AAG TCA GGC G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41184 | 0.40 uM |
| 41185 | 0.40 uM |
| 41190 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.