For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:85216246-85216393 148bp TTCCTTTCTTGTCTCATGTGGA AGGTTTTTGTTGTAGTGGTGGTG
Mut= 148 bp
Wt= 148 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGCTCGGCGTCCGGGGGGCCTGAGGCCCGGAGTGGGGCCGGGCAGAGGGGCGCAGCGTTGCCGATTCGGGGAACCGGGCTAATAATTCCTTTATTAGGATCCATTTTTTTCTATCACAAAGTTGAAAGTTAAAACGTTTGAAATAGTTATTTTTCTTTTTTTTATTATTATTACAGCTTTACCAACAGGGAcgcttgtgtcagctcggcagtgaattctgtgaattggaagtttttgctaaagttttgagagctttggataaaaggtaaatttgtgtgtatgtgtataagctttcttgcttccttccttcctttcttgtctcatgtggatcaagatggccttgaacttgttaaacttctgatcctcctgcctctatttaaatgcttggattacagataatggacagggtcacccccttgcccccaaaaTATCCACCACCACTACAACAAAAACCTGCTAAAATGTATATAACATAAAATTTGCCACTTGTATCATTTTAAAATGCATAATTCAAGGACTAGAGAGATGTCTCAGTGGTCAGGAGCACTGGCTGTTCTTCCTGCAGACCTGGGTTCAATC
This mutation is a 237 bp deletion beginning at Chromosome 11 position 85,216,273 bp and ending after 85,216,509 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41163 | TTC CTT TCT TGT CTC ATG TGG A | Wild type Forward | A | |||
| 41164 | AGG TTT TTG TTG TAG TGG TGG TG | Common | A | |||
| 41165 | GAA CCG GGC TAA TAA TTC CT | Mutant Forward | A | |||
| 41166 | Fluorophore-1 | CAA GAT GGC CTT GAA CTT GTT AA | Quencher-1 | WT Probe | ||
| 41167 | Fluorophore-2 | TTA CAG CTT TAC CAA CAG GGA TAT C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41163 | 0.40 uM |
| 41164 | 0.40 uM |
| 41165 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.