For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:59042566+59042681 116bp TCCACCATCGTCTCTTGTCT AGGGGCATAGGAGGTAAGGA
Mut= 112 bp
Wt= 116 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGATTTTTGTTTCTTAATGAAAATTGGGTTAAATTTCCTTCCCTCCTTTCAAACTGCATGCACTCTTTGAAAATCTATCAAACATACTTTTTTATAGCAGCACCTAACTTCCGGCCCTTTCcttacttcctcctctgtaagtgtgcttcgcaatgctctggtgtgcgattgtcatatgttatttctttttaggtccccatcctcagtaaaaaagaggacgtctttgcatatttagctaagtattctgtgccaatggttcgagcaacgtggctgatcaagatgacttgtgcctattactctgctatttctgaagctaaaattaagaaacgccaggctcccgatcccaatttgggtaagtgagccagtgggcaatgttttatatttcactactggttcttcaaataattgtcacctgcaccctctgagaactcagcatcccagcccccacccccaccccccctccccaccccatgcagctgacaggcagcaagccctgttgatatctccaccatcgtctcttgtctagacagaagcaacctctggctggctttcctgcatgcttttgctgcagctgagcaggcctccagtcCACGTAACTGTTCCTTACCTCCTATGCCCCTGCCCCTGAGCTCACTGCCTCTTTTTCTGGTCAGTGCCACTGCCTTTGCGTGTGTAATGACAGTTGATGCCAGTTAATCTTG
This mutation is a 468 bp deletion beginning at Chromosome 3 position 59,042,183 bp and ending after 59,042,650 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41153 | TCC ACC ATC GTC TCT TGT CT | Wild type Forward | A | |||
| 41154 | AGG GGC ATA GGA GGT AAG GA | Common | A | |||
| 41155 | CCC TCC TTT CAA ACT GCA T | Mutant Forward | A | |||
| 41156 | Fluorophore-1 | AGA CAG AAG CAA CCT CTG GCT | Quencher-1 | WT Probe | ||
| 41157 | Fluorophore-2 | CGG CCC TTT CCA CGT AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41153 | 0.40 uM |
| 41154 | 0.40 uM |
| 41155 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.