For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:24220325-24220425 101bp TGCTTTTAGACTCCGGTTGC CAGCCATGGTATGGTCCAA
Mut= 81 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGCTGCAGGTCTGGTACGCGGACCCAGGACCTCCTGGCCAGTCCCTCCTCGGACCATCAGGATTATGCAGAGTCCCAGGGCCTAGAAGGCCAAATACAAATGCATGCTTTTAGACTCCGGTTGCCATTGCTATCCTTACCCCttatccagggtctgaggctgggaatctgcttagggatagaatgtttggaccataccatggctgccctgtctttgcagggaaccagccaggaccccatctccagttccagaaaccaaagaagaggacccaagtccaggtaaacgttagctgctttttatgggtgctgtccctggcctttctctggcttgctgtcatgggggaatccatcctgggacagtgaggaggaattcttgcatggttcttgacgttcatagcatgtgcaccgagttctcaagatctcgaggagctggaacttttgacccaggctctggagaaggctgtacgtgtgaggaaaggcgtgtccaatgctggacaaagagacagaacccccactctgacatctaaggcagccacttctggtgccgctgccgcctcccatcctcgggctcccagccggggtggcagccgtgtattgggtacaagatccaccaagggtatacagcgggccacagcccctcccaaggattaccctgagcacagactacgatcaaagggtgataagacccatgtaagaacacaagaccaaactactgggtatggaccagacctcagggaccaacaaatgaccccgtcatctgctcatcacaccacagaactcttcgcattaaaggagaaggggtaagcttcccagacgctcgtatcctgacagggcattgagctggttgaggaagcccctggtgccgacccgtaagggtcatgcactgaagcaaacagggcagaacagggttgggatggtatcaggtttgtcgttctggagcctaaccagcccatgagctctctggactgggcgagcacccaccctcctccagaagccgttttcaaaaagcttgtcagaattaagctgttaaaggagaggaggtgagaaggttcgccccaatgggTTCTGAGCCATGAGTAAGAATGACAGTCCTAATGCCGGGCTTGGTGGCCCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCGGGGCCAGCCTGGTCTACAGAGTGAGTTTCAGGACAGCCAGGGCTACACAGAGAAACCCTGT
This mutation is a 920 bp deletion beginning at Chromosome 17 position 24,219,468 bp and ending after 24,220,387 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 41039 | TGC TTT TAG ACT CCG GTT GC | Common | A | |||
| 41040 | CAG CCA TGG TAT GGT CCA A | Wild type Reverse | A | |||
| 41041 | CAA GCC CGG CAT TAG GAC T | Mutant Reverse | A | |||
| 41042 | Fluorophore-1 | TGA GGC TGG GAA TCT GCT TA | Quencher-1 | WT Probe | ||
| 41043 | Fluorophore-2 | CCC CTT CTG AGC CAT GAG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 41039 | 0.40 uM |
| 41040 | 0.40 uM |
| 41041 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.