Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mut= 94 bp
Wt= 103 bp
Wt Sequence (insertions with carrots ^^ ):
AAGGGCAAGAGTAAGCTAAAGTGAGTGTTCCTGCTGCCCCGTGGGGTGCTGGGAACAGTACACTGCGGGATAAAGTGACTGCTCTCTGCTGCCCC^ataacttcgtatagcatacattatacgaagttat^TGGGGTGCTGGAGATAGCACACTCCTGTGAGGTTATATTCGTGTGAGC
Loxp Site 3' end of Exon 3
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39130 | TCT GCT GCC CCG ATA ACT T | Mutant Forward | A | |||
| 39132 | GCT CAC ACG AAT ATA ACC TCA CA | Common | A | |||
| 40970 | Fluorophore-1 | GCT GCC CCG TGG GGT | Quencher-1 | WT Probe | ||
| 40971 | Fluorophore-2 | TCG TAT AGC ATA CAT TAT ACG AAG TTA TTG GG | Quencher-2 | MUT Probe | ||
| 40972 | TGG GGT GCT GGG AAC AGT A | Wild type Forward | A |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39130 | 0.40 uM |
| 39132 | 0.40 uM |
| 40972 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.