For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:71280572-71280660 89bp CATTGGTACCCTGCTGTGTG AGCATCTGCTCAGTCGTCCA
Mut= 90 bp
Wt= 89 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertions with carrots ^g^ (CTTAGA insertion):
CTGACTCCTCCAGCTAGGCTCCACTTAAGGCCTTTAGAAGCTCCCCCCCCCCCATAGTGCTACCATTTAGGGACAAAGTATTTATAGCAGAGCCTATGCAGGACATTTCACATCACAACAAGGGTCAGCATGGGAGGACTGG^agactctcttaaaactagtggtcactaaagtgagaccctgttttctctgtctttaggtatcgggtaaactttagacccagatttgtcactagatacaagatagtgacacagttggaatggagatgctgtcctggctttagaggaccagactgccaagaaggtcccaaagaccacatgaagaccccccggcccccatcagctcgaccaaaaaacaacctgaagaaagccacaggtaatgaatgtctcattggtaccctgctgtgtgtggtcacatttgatgtccctggtgttgttaccaag^GACAGGGTTGATAATGGACGACTGAGCAGATGCTCATGTAGAGGGATTGTTATCTGAAGGGGCAGGAGTGGTTGGGTCGCACATATTTCCTTGCAAGTAAATTTCCTCGTTAGGGCCACTTGTAGATTAGCCAGGAGTGGTGGTACACATCTGGGAGGT
This mutation a 300 bp deletion beginning at Chromosome 17 position 71,280,606 bp and ending after 71,280,905 bp (GRCm38/mm10). In addition, there is a 6 bp insertion (TCTAAG) at the deletion site, that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39942 | CAT TGG TAC CCT GCT GTG TG | Wild type Forward | A | |||
| 39943 | AGC ATC TGC TCA GTC GTC CA | Common | A | |||
| 39944 | CCT ATG CAG GAC ATT TCA CAT C | Mutant Forward | A | |||
| 39945 | Fluorophore-1 | CAC ATT TGA TGT CCC TGG TG | Quencher-1 | WT Probe | ||
| 40859 | Fluorophore-2 | ACT GGC TTA GAG ACA GGG TTG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39942 | 0.40 uM |
| 39943 | 0.40 uM |
| 39944 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.