For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:128380453+128380544 92bp CCCTCAATGTTGCAAACACA GCCCTCAACCTACCAAAGTACA
Mut= 87 bp
Wt= 92 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case; and insertion with carrots ^g^ (GTCC insertion):
GGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACATAGAGAAACCCTGTCTCGAAAAAACAAACAAACAAACAAAAGAACAGAGGTATCAGCTGTCACCCTCAATGTTGCAAACACAAAGGGGGAAGATTCTGAGTGCACCTCTCTT^ttcaggaggtcagaggcatctgtactttggtaggttgagggcatgaacctgttccgtgtcttttatatcctcatatagacagtgaacctgctcctgaataagggagccagcctgaatgtctgcgataaaaaggaacggcagccgctgcactgggcagcttttctaggtgagagacactgtaggaaaagggagaatttgattgttaggatccccagggcaagtttcaccctttggggg^TGGAGCCTGGAGCCTTTGGGGGAGGAGCCTAGAGCCTTTGGGGAGGGAGCCTGGGGCCtttgggggtggagcttagggcctttgggtttacCCTCCACCTGCTTGCTTCTCCTTCCTTCCTTTCCTTCTTCCTTCCTTTCCTTTCCTCCCTCCTTCCGTTTCTCATTCCTTCCTTTTTTTCTTCATAGGGCATTTAGAGGTCCTGAAACTGCTGGTGGCACGTGGAGCA
This mutation is a 237 bp deletion beginning at Chromosome 10 position 128,380,503 bp and ending after 128,380,739 bp (GRCm38/mm10). In addition, there is a 33 bp deletion (TTTGGGGGTGGAGCTTAGGGCCTTTGGGTTTAC) 58 bp after the exon deletion and a 4 bp insertion (GTCC) at the exon deletion site, that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40836 | CCC TCA ATG TTG CAA ACA CA | Common | A | |||
| 40837 | GCC CTC AAC CTA CCA AAG TAC A | Wild type Reverse | A | |||
| 40839 | TCT AGG CTC CTC CCC CAA A | Mutant Reverse | A | |||
| 40841 | Fluorophore-1 | TTC AGG AGG TCA GAG GCA TC | Quencher-1 | WT Probe | ||
| 40842 | Fluorophore-2 | CCT CTC TTG TCC TGG AGC CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40836 | 0.40 uM |
| 40837 | 0.40 uM |
| 40839 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.