For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:110775322-110775426 105bp CAGGACTGGCTAGCTGAGAGA TCCAAACGCATGCTCATAAC
Mut= 100 bp
Wt= 105 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CATCCCAGCAGGGAAGGAGGGATTGTGGCAAGACGGTTGCAAGTTGGAGGTTACTTTGGTGTACATGAGTTCGTTCCAGGCCAGCTAGGGTCACATATGGAGACCCATTCCCAAAAGCACCCCCCTCTTCCACTTTAGGACCAGGgtgtgagggttgtgttggaggatgaggcccctaacttacccgtcctctctgctctgttttctttgcagggtgtgtctgcagcagggcaggtggtatccctaaaggtgtggctgattgatgacattctggacaagatcaacagccaccttccatcccacattcggattctgggtaagcttccctgtgtgaccacctgagtgctctcatatggacagaggctgtgcttgctctggccaagcaggttctcagcggggtgctgtgaaggttcagtgttgctcctcaggactggctagctgagagagaacttccatggcctttggctgtactgttctaatagtatGTGGGTACTTTTCTCATCAGCAGTGGTTATGAGCATGCGTTTGGAATCGGGCTGGGTGCCTGTTGGGGCAGGTGGCACCAGAACCACAGTGTCAGGATGTCCCACCTTCGAGGTGTTTCTGCTCACCTGGGTTTCCTACATCCTGTCCCCCAGGATTGAAG
This mutation is a 340 bp deletion beginning at Chromosome 5 position 110,775,367 bp and ending after 110,775,706 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40556 | CAG GAC TGG CTA GCT GAG AGA | Wild type Forward | A | |||
| 40557 | TCC AAA CGC ATG CTC ATA AC | Common | A | |||
| 40558 | TCA CAT ATG GAG ACC CAT TCC | Mutant Forward | A | |||
| 40559 | Fluorophore-1 | ATG GCC TTT GGC TGT ACT GT | Quencher-1 | WT Probe | ||
| 40560 | Fluorophore-2 | ACC AGG GTG GGT ACT TTT CTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40556 | 0.40 uM |
| 40557 | 0.40 uM |
| 40558 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.