For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:36619599-36619723 125bp GGATCGAGACTTTAGTAGAAGAGC GGCTTGGTGACACACTCTACA
Mut= 120 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case; and insertions with carrots ^g^ (CCAAG insertion):
CAGGACAGCCAGGGCTACACAGAGAAATCATGTATTGAAAAACCAAAAAAGAAAAAAGAAAAGAAAAGAAAAAATACTTACAGTAGGTTAGCTTTACCGgtttttaaactctgggattcatttaagaattgataatatattccttttggaacatggaaacttgtggtcctccgtagtgacataaaataattgcctgtctactgtgcctggtagaaagctgactgtcttctctctcacacagagctctgggatcgagactttagtagaagagctctgctgcagactgaaagacctacagagcgagcaaggtgagcaggctggggcaggtagagccctacaggGtccttctcagtgtagagtgtgtcaccaagccAGCATTCCTCATTACCTCAGCTCTGCACAAGGCTTCAGTGAAGTCCTTAGTGGCCACATGGGAAATCCCTGCTCCAGAGGAGGGCTGTAGTCCGTGGGCACCTTCTAAGGCTTCACTTGGGGGTTCAGTCATTTAAGTTCCTAAGTGTTCTGCAGGACTCCAGGAAGGGGCTGCATACTCTGAAACCC^ttttctgtccttgtcaa^GGTCATTGTCAGCGTATACTCTTGAAGCCTTGTGTTAAGGGTCCACCTTATTTT
This mutation is a 242 bp deletion beginning at Chromosome 5 position 36,619,631 bp and ending after 36,619,872 bp (GRCm38/mm10). In addition, there is a (CCAAG) 5 bp insertion and a 17 bp deletion (TTTTCTGTCCTTGTCAA) 220 bp after the 242 bp deletion that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40530 | GGA TCG AGA CTT TAG TAG AAG AGC | Wild type Forward | A | |||
| 40531 | GGC TTG GTG ACA CAC TCT ACA | Common | A | |||
| 40532 | GGG CTA CAC AGA GAA ATC ATG T | Mutant Forward | A | |||
| 40533 | Fluorophore-1 | CTG CTG CAG ACT GAA AGA CCT A | Quencher-1 | WT Probe | ||
| 40534 | Fluorophore-2 | TTA GCT TTA CCG GTC CTT CTC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40530 | 0.40 uM |
| 40531 | 0.40 uM |
| 40532 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.