For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:63169613-63169703 91bp TCTGACTCAAAGCTTGTATGTAGGT CCAAAACGAACACATGAAACTG
Mut= 109 bp
Wt= 91 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case, insertions in^^):
CACCATTGTCATTTTCAGCAGGAGTCACTTCTCAATTCCCGGAGTAAAATATCAGTGTGGTTTGGATACTGCCGACTCATCTCGCTGTTACACTCAAACAATACCGAACCAAAGG^T^TTTACTTCGCATTCTGACTCAAAGCTTGTATGTAGGTC^ACCAAGGCA^tcctcaggaaacagctggagccatctctactcttgatattattcagtttcatgtgttcgttttggttgtagtttgttgtagttgttttgaggcagggcctcctatagctcaggctgacctccaatatgtaggctaggatgaccttgaacctctgacgctgccacctccacctcccctgtaaatcccaccatccctgacaactctccggtttctgctgtgtctgatggcgatatactcgtccttgcaggtggtattgtgaaggcaaggagcttgaaaactctccagatatccacattgtgcaggcaggaaaccttcactcactgaccatcgccgaggccttcgaagaggacacaggacgatactcatgctttgcttccaacatttatgggacagattcaacttccgctgagatttacatagaaggtaaagctaaatacttttggagtgtgacatgttctaactatctgtagttacgtaaacatttgtaggggggggcttttctacccatctagacactggggatactagtcatgaaccaagtagacaaaactcttcagcggatgtgccgatgaattcccgTTATAATGGGAGAAACTCCAAACAAATGaGATAAACCATGATAAATACATAACATTGCAAAAGAAATAGGAAAAGAGATGATCAATAAAGAGCTCACTCACCAGGTGACATTTGAGGGAAAAGCTGGTGGCCACAGGAGAG
This mutation is a 579 bp deletion beginning at Chromosome 10 position 63,169,099 bp and ending after 63,169,677 bp (GRCm38/mm10). In addition, there is a 9 bp insertion (TGCCTTGGT) at the deletion site and a single bp insertion (A) 38 bp after the exon deletion that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39524 | TCT GAC TCA AAG CTT GTA TGT AGG T | Common | A | |||
| 39525 | CCA AAA CGA ACA CAT GAA ACT G | Wild type Reverse | A | |||
| 39526 | CTT TTC CTA TTT CTT TTG CAA TG | Mutant Reverse | A | |||
| 39527 | Fluorophore-1 | CAG GAA ACA GCT GGA GCC | Quencher-1 | WT Probe | ||
| 40474 | Fluorophore-2 | ACC AAG GCA TTA TAA TGG GAG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39524 | 0.40 uM |
| 39525 | 0.40 uM |
| 39526 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.