For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:34644899-34645023 125bp AGCCTGTGCTGACGGAGAGT GTTGCAGAAAGCAAGCATGA
Mut= 117 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case and insertion with carrots ^g^ (GTCTATA insertion):
GTGTTTCACCACGCCCGGCTTTCATATTTTTACATATCTGTAGTTCATTACTATATTTAAGTGTTTGGTGCTTAATTTATTCCATATTTATTCAGTGGGAACACCTGAATGAATGGTTGTCTATAAGGCGGATGTTGTT^ttgcttaggcattagttagccctgtagatagaaccagctgctggttttattaataagccagacaacaacaaaaatcatcaacaaaaacccaaaccctattcgttgatttctgtcttcccccttacagtctggagagaagaagaaggatgacgaaacagttgatagcctaggtatgaccccccaccccccatgcaggaaccctaagaccgcacagcctgtgctgacggagagtggcttccctcagccactgctgtcatccatctctacccg^AGGGCTGCTGTGGGAATCAGCCTGTGGGTATGCTTGCCCCGCTTGAATCATGCTTGCTTTCTGCAACCTAAGGTGGAAAATTGTTTTAACTGAAACTTCTGAGTTGTAAACATTGATAAGTCGGACTACACCAGCCAT
This mutation is a 270 bp deletion beginning at Chromosome 18 position 34,644,966 bp and ending after 34,645,235 bp (GRCm38/mm10). In addition, there is a 7 bp insertion (GTCTATA) at the deletion site that will not alter the results of the exon deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40359 | AGC CTG TGC TGA CGG AGA GT | Wild type Forward | A | |||
| 40360 | GTT GCA GAA AGC AAG CAT GA | Common | A | |||
| 40361 | GGG AAC ACC TGA ATG AAT GG | Mutant Forward | A | |||
| 40362 | Fluorophore-1 | TGC TGT CAT CCA TCT CTA CCC | Quencher-1 | WT Probe | ||
| 40363 | Fluorophore-2 | TGT TGT TGT CTA TAA GGG CTG CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40359 | 0.40 uM |
| 40360 | 0.40 uM |
| 40361 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.