For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:4514262+4514373 112bp GGAGAACCAGGAACTAATGAAGA GGCTGAGCTCTGAAGCTAGG
Mut= 119 bp
Wt= 112 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAATTCTCACACACATTATATACAATAATTACTCTTTTCAATTTGATAATGCAGATCCAAATCCAAGAAAGAGAAAATGAAATTGGACGAGGTCAGGAATAAAATGGAGAAATTTTAAATTACAGTATTGACTCTtttgtaggcccttccaacagcatacacattgttaaatccctttgttctcgcccaccccaacctctctgcactttagcttcgagaactccgctccaagatgctttctaaagaagcttgctgtcaggagctgaaggtggaaatggagagctataaagaaagcagtgccagaaagtcagctctcctcacgtctctgaggggcaggatggaggagctccaggaggaatcagcagcggtttcagcttctaaaagcagagcagaggcctctgttcacgccatgatgaaggagaaccaggaactaatgaagaaagttctagaactggatgagaaattacagtaagaaatttggaaacatcccccagTTTGTTAGTGGCTATCCTAGCTTCAGAGCTCAGCCTACATCTTGAGTGATCTTTGAATGTTTTATATGACTTTCCCTTTAAACTCAAGCTGAAAAAACAATTATAGCCCTCAAATATCTTTGTAGTCTTACAAACTTTGCTCAAGTTCAAGTGTTATTAAGTATTTCATCAAACACAGTG
This mutation is a 359 bp deletion beginning at Chromosome 10 position 4,513,980 bp and ending after 4,514,338 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40302 | GGA GAA CCA GGA ACT AAT GAA GA | Wild type Forward | A | |||
| 40303 | GGC TGA GCT CTG AAG CTA GG | Common | A | |||
| 40304 | CAG ATC CAA ATC CAA GAA AGA G | Mutant Forward | A | |||
| 40305 | Fluorophore-1 | TGG ATG AGA AAT TAC AGT AAG AAA TTT G | Quencher-1 | WT Probe | ||
| 40306 | Fluorophore-2 | ACA GTA TTG ACT CTT TTG TTA GTG GCT A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40302 | 0.40 uM |
| 40303 | 0.40 uM |
| 40304 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.