For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:25223685-25223780 96bp GTCCAACTGACTGCGGGTAG CCTGCCAATGTTCAAGGAGA
Mut= 97 bp
Wt= 96 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTGCGCCTGCTCCTCCCGAAGTGCTCCTCTTCTACAGCTGTTCCGCAGTCGCCGCCGCCATGAGGGAGATCGTGCACCTGCAGGCTGGGCAGTGCGGCAACCAGATTGGCGCCAAGGTAGGAGGCTAGGTTTCTGCGAGCCAGACGCCACTGGGACAGCCAGCCGGGGAAGATGGCGGAAGcggcccggagcgtcgcccttcattgcgtcctggataccggcgtacgctgggccgagacgtagcgccggtggctggtgtcggtggggcggacggtgcgcggcccttagggattcgtcgccctggcgctcctgagactggagggagggggagggcctgccgcacccatccggggcggggctgccttggagcgcaccggccggccggcgtgactcagctaacgcccgactcccttgcagttctgggaggtaatcagcgacgagcatggcattgatcccactggcacttaccacggagatagcgacctccagctggagcgcatcaacgtgtactacaacgaagccaccggtaaggctcctctaccccatccatcctcctcaccacccttccagtttgagcacacttgacgtccccctgtcccaaccaggtggcaagtatgtgccccgcgccgtgctcgtggacttggagcccggcaccatggactcggtgcgttcagggcccttcgggcagatcttcagacctgataacttcgtctttggtgagtgtggtggaggtgtggacgggcttgctacccatgaggctcaaaggtcaaggggctgacctaaagttcttccttaatagccaccaggtgtacactttcttgccctctgagtcactcaatcccttggccgaaagcagctttaggaggaaggtccaactgactgcgggtagattagttgctagtagagagtatgagaagacctgaCCTAGTGGCAGGGGCCCTGTACTCTCCTTGAACATTGGCAGGGGTGCCTTTGGAAGTATTTACTGTCTTAGCTCTAGTGTGTTCTGTACATCTCCGTCTGGTCTCCCCCACCCCCCATCCCCAATCTATGTATCCCTGCCTGGCCTCTTTAACTGTAGACCAGGCTGACCTTAAACTCA
This mutation is a 742 bp deletion beginning at Chromosome 2 position 25,223,727 bp and ending after 25,224,468 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38908 | GTC CAA CTG ACT GCG GGT AG | Wild type Forward | A | |||
| 38909 | CCT GCC AAT GTT CAA GGA GA | Common | A | |||
| 38910 | AGG TTT CTG CGA GCC AGA C | Mutant Forward | A | |||
| 40007 | Fluorophore-1 | TGC TAG TAG AGA GTA TGA GAA GAC CTG | Quencher-1 | WT Probe | ||
| 40008 | Fluorophore-2 | ATG GCG GAA GGC CCT AGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38908 | 0.40 uM |
| 38909 | 0.40 uM |
| 38910 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.