For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:72471121-72471217 97bp TGGGACAGTGAGATCAAGCA AGGTTGCCCTCCAGAGAGAG
Mut= 98 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (CT insertion):
ATTAGGATCCAGTGGCTTGGGACAGACACACCTTGGGAGAGGTGCCACATCTCCAGCCCTGGTCATAGCTTGCAGTGCATAGTAGCTTGGTCAGGCCTGCATGAGAAGGGAAGATGGAAGGGTCAGCCTGTCTTGGGACAGTGAGATCAAGCAC^aacagggaagcttgggcaggatggccgtgtgcggtggacagtggatccatcaggtcctctctctggagggcaacctgatggatcaccaaaaggaacctggggcaccccctgagctcacaaggcccatctctttcctgctagtaatctgcaagcagcaggccccagagctggagcccacctcagccatgccccctctgccacaacctccgctggctcccacagcgtccctcactccggcccagggcaccccatcaatggacgagctcatccaacagagccagtggagtctccagcagcaggaacagcacctgctggccctgcgccaggtatgcctgcatgtactgtcagtgaccctggagtcaccttccagtaggtctgtgggtcatccacaggcatcgctcagtggacttgtacccattgtggatgccaacacatggcggcttaggtacctaccattcttaatgagtagggaggggcattattggccccatcttttaggttggttctgttgccaaattctatagg^GATGAGCTACCTGAAATGAAAGGAGAGAAGACATACAGACCTGAGTGCCAGCCCCACTCAGGGTTTCCTTGCTTACCACCATCACATATCATGCATGGATGTTTACCATCAGTCATAGTCTGGACAGTTAGGTCTTAGACAGCAGAACCAGCCTCTACTCTTGGTGACCTATAC
This mutation is a 525 bp deletion beginning at Chromosome 8 position 72,470,672 bp and ending after 72,471,196 bp (GRCm38/mm10). In addition, there is a 2 bp insertion (CT) at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39949 | TGG GAC AGT GAG ATC AAG CA | Common | A | |||
| 39950 | AGG TTG CCC TCC AGA GAG AG | Wild type Reverse | A | |||
| 39951 | TAA GCA AGG AAA CCC TGA GTG | Mutant Reverse | A | |||
| 39952 | Fluorophore-1 | ACA GGG AAG CTT GGG CA | Quencher-1 | WT Probe | ||
| 39953 | Fluorophore-2 | CCT GAT GAG CTA CCT GAA ATG AA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39949 | 0.40 uM |
| 39950 | 0.40 uM |
| 39951 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.