For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:79386924-79387018 95bp CTGTCCCATCTGTTGCACTG TTCATGCCGAGAATGTGAGT
Mut= 95 bp
Wt= 95 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAGTGGTAACTAAGTCACAGTCATATGGCTTTAAAAGTCTTTATTCTGTGTCAGTGTTGGTTGATGATTATGCATTTATTGAGTTTATTCTTCATTTATGTCTCTATCTCTTACAatagtggagatgctacatgtcaaggcatatataaccgcacttaatgctgaaattaatatagacagaagagcatgtcatcacattttaaactttggatcttgaattgataagatataataaaacttggttcattattttataaaataacctgctgtttccttttagaaatgttatgaacagaagcagtacaaaaatggcctcaagttttgcaagatgattctttctaacccgaagtttgctgaacatggaggtactgtcccatctgttgcactgtgctttgggggaacacaattctaaagccaggcaggacttctgaaagtgcaggaggactcacattctcggcatgaatgtttagcatttcttggttatgtttcgagtgaatcttaggttgagctagtttcatgctctagtatgtgcagtgccttgacttttaatgaggaagtcggtgagagacaattggatgaggtagtgtgcatgttaacatccctctcaGAAGTGCTTCAGATACCCGATGAGCTCAGACTTTGGAATAATTGTTTAGATTACCAGTTATACACACCAATTCAAAAAATCTTGAAACTCTAGTTTCAACTCTTAG
This mutation is a 492 bp deletion beginning at Chromosome 14 position 79,386,780 bp and ending after 79,387,271 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39856 | CTG TCC CAT CTG TTG CAC TG | Wild type Forward | A | |||
| 39857 | TTC ATG CCG AGA ATG TGA GT | Wild type Reverse | A | |||
| 39858 | CTG TGT CAG TGT TGG TTG ATG A | Mutant Forward | A | |||
| 39859 | GCT CAT CGG GTA TCT GAA GC | Mutant Reverse | A | |||
| 39860 | Fluorophore-1 | CAG GAC TTC TGA AAG TGC AGG | Quencher-1 | WT Probe | ||
| 39861 | Fluorophore-2 | TTC ATT TAT GTC TCT ATC TCT TAC AGA AGT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39856 | 0.40 uM |
| 39857 | 0.40 uM |
| 39858 | 0.40 uM |
| 39859 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.