For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:72960945-72961044 100bp TACTGCTGCGTCAGTCACGA CAAAGAACATCTTAAAATAGAGCCAAC
Mut= 99 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGGTCAAGCAGTTATCTGGAGTTGACAATCTCTTATTTTTTTAATAAGCCCTAGTCATTGCTACAAAAGGTATATGTGACTGAATTAAATCTAGATTTTGAGTTACGTAACCTCACctgaacttgatagctatcatagcataagtattcaaaatcttcttattatcatgacgaagaggaaaaaaagacaaacgtaattattgagagtgcaaagggtcttaaaaggtgtgtgcttagagtattaatgataagaaaacagactaagtacatctgattgcattgccaattacgtttttgtttgtttgcttgtttgtttgtttaaaaatattttttccaggcaaaatgtgaagagcgtggctgttgctggcgtccatggaacaacactattattccttggtgcttctttgcagataaccatggctatactgctgcgtcagtcacgaatgacaacagtggtaagggtgctgccaccatgatagcccaATACATGTTCTAAGTTGGCTCTATTTTAAGATGTTCTTTGGAAAGAGCATCTTCAATAAGTACACACATCAAAACTTTTTTAAAATCTTTTTTTTATTAGATATTTTCTTTATTTACATTTCAA
This mutation is a 366 bp deletion beginning at Chromosome 3 position 72,960,985 bp and ending after 72,961,350 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39759 | TAC TGC TGC GTC AGT CAC GA | Wild type Forward | A | |||
| 39760 | CAA AGA ACA TCT TAA AAT AGA GCC AAC | Common | A | |||
| 39761 | TTG CTA CAA AAG GTA TAT GTG ACT GA | Mutant Forward | A | |||
| 39762 | Fluorophore-1 | CTG CCA CCA TGA TAG CCC | Quencher-1 | WT Probe | ||
| 39763 | Fluorophore-2 | TGA GTT ACG TAA CCT CAC ATA CAT GTT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39759 | 0.40 uM |
| 39760 | 0.40 uM |
| 39761 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.