For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:26390853+26390950 98bp CCTAGGAAGCCCTGAGTGAG ACTGCCCACAGTGAAGCTCT
Mut= 95 bp
Wt= 98 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ATGCTAAGCTAAACAGGCAGGCTGCTGCTGGCTATCTGAAGCTGGGCATGTGTCCATGTGAAACCAGTCTTCATTTAGACCAGCTGGTTATTTGTCCAGGCCTAGGAAGCCCTGAGTGAGAGACttcctctgtgaagagaggagaaccagtttcctctggttccaaagtatctcatggagagcttcactgtgggcagttgtggctcccagaaggccttcacacccaagaaagaggtagtggtagtgtctttgctggcatgaagggcctcagtgactgagttgttatctggtgtaaaccatgcacctgctattgtggcttatttcctttcagagacaccaccatgtatgctgtgtctgctgacagcaaaggcttggacactgtggtggatctgttggctgatgtggttctgcacccccgactgacaggtgtggctctgaggctgggtggtcaggaggagctttggaagggctataacttcctgtggggaggcactgttagagccgggcactcatgtgccaatcattggagagtgccagtgctgaaacaagcctgcagtgttctacacaatgtttcatcctttaatatatctaaacgagaccttaaagggtttactaaagttctgctcagaaatgtccctcatcccgtgtgTAAGCATGAATGCCATGCCTACAGAAGTTTCTCTTGCCTGGTCTCCTTTATCCTCCGAGTCTTTGAGTCCTGTTAGGATGGGAGAGGGCGCAGCA
This mutation is a 525 bp deletion beginning at Chromosome 2 position 26,390,877 bp and ending after 26,391,401 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39535 | CCT AGG AAG CCC TGA GTG AG | Common | A | |||
| 39536 | ACT GCC CAC AGT GAA GCT CT | Wild type Reverse | A | |||
| 39537 | AGG ACT CAA AGA CTC GGA GGA | Mutant Reverse | A | |||
| 39538 | Fluorophore-1 | TCT GTG AAG AGA GGA GAA CCA GTT | Quencher-1 | WT Probe | ||
| 39539 | Fluorophore-2 | AGA GAC TAA GCA TGA ATG CCA TG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39535 | 0.40 uM |
| 39536 | 0.40 uM |
| 39537 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.