For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:31764235-31764327 93bp TGAGAAGAGAACCCCTTTGC AGCTCAGGAGTTGCCATACC
Mut= 107 bp
Wt= 93 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
TAACTGTACATAATATCTTTAAGAATTTTACATGTGAACAAAATTTCTTCAAAGTTAGTTTTTTATTTATGGTTACACATCACTTCTCGAAACCTTTTGGGATTTGTTTCATTTCAGATATTTTAaaaataggactgggtggtttggctcaagcCATGGTTTTATAGCCAAGTAAATTTGTAAAGGCTTTTACTTGTCTTAGCTGTAAAACACCCAAGattttgttggcgagacttgcagagtagagttgtggaaatattaatttgttagttaataatgttggatttcattcatactacattattttttattaaagtgcagtttcctcttttcacaggacaatgagaagagaacccctttgcatgctgctgcctatcttggtgacgcagaaatcattgagctgcttattttatctggtatggcaactcctgagctgagttcatggtgttcagtttgatgtatgagtgttcctatggaatgcatagcctatgtcttagtattggtttcataagttaaccaattataatagcaaactttgatcatagaacctgttttgggtgcttaaagtactttaagaaatagaacaaagatttctgtccttacAGACTTATTAGTTCCATAAATACAAGTCATTTTATAGTTTGTTTAAAAGATAATAATTGCTACTGTGGAAAAATGAAAAACATAGATTGGGAAGAATAGGAAAGAGACATATGTCAGGAAAGG
This mutation is a 385 bp deletion beginning at Chromosome 14 position 31,764,067 bp and ending after 31,764,451 bp (GRCm38/mm10). In addition there is a 29 bp intronic deletion, Chr 14 :31,764,516 -31,764,544, which is 64 bp before the 385 bp deletion, that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39518 | TGA GAA GAG AAC CCC TTT GC | Wild type Forward | A | |||
| 39519 | AGC TCA GGA GTT GCC ATA CC | Wild type Reverse | A | |||
| 39520 | CGA AAC CTT TTG GGA TTT GT | Mutant Forward | A | |||
| 39521 | AGT CTC TTG GGT GTT TTA CAG C | Mutant Reverse | A | |||
| 39522 | Fluorophore-1 | TGC TGC TGC CTA TCT TGG T | Quencher-1 | WT Probe | ||
| 39523 | Fluorophore-2 | CAG ATA TTT TAC ATG GTT TTA TAG CCA AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39518 | 0.40 uM |
| 39519 | 0.40 uM |
| 39520 | 0.40 uM |
| 39521 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.