Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mut=114 bp
Wt=114 bp
Wt Sequence (bp changes in brackets with wt first):
ATTGCGACCTCTGTGGTAGGCCATTTCCAGCCTGCCCAAGTAACCAGAGCCCCTTACCCCTCAGATCA(cc/tg)CTGACGACCATTGGCTACGGGGACAAGTACCCTCAGACCTGGAA
Kcnq2 T274M (ACC -> ATG)
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39097 | ATT GCG ACC TCT GTG GTA GG | Forward | A | |||
| 39098 | TTC CAG GTC TGA GGG TAC TTG | Reverse | A | |||
| 39099 | Fluorophore-1 | TAC CCC TCA GAT CAC CCT GA | Quencher-1 | WT Probe | ||
| 39100 | Fluorophore-2 | CCT TAC CCC TCA GAT CAT GC | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39097 | 0.40 uM |
| 39098 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.