For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 72 bp
Wild type = 113 bp
Fam=Mut
Hex=WT
>chr11:119135923+119136035 113bp ACTTGTTCCTGAGCCCAAAC CTGGGCCTAGGAACACATACA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38768 | ACG GGT GTT GGG TCG TTT | Mutant Forward | A | |||
| 38769 | ACT TGT TCC TGA GCC CAA AC | Wild type Forward | A | |||
| 38770 | Fluorophore-1 | TCG GAT CCG TCG ACA AGC TT | Quencher-1 | MUT Probe | ||
| 38771 | Fluorophore-2 | AGC CCA GCC CTA ACC TGG AG | Quencher-2 | WT Probe | ||
| oIMR1749 | CTG GGC CTA GGA ACA CAT ACA | Common | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38768 | 0.40 uM |
| 38769 | 0.40 uM |
| oIMR1749 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.