For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 88 bp
Wild Type = 148 bp.
>chr13:94978617+94978764 148bp CTGACAAAGACGATTTAGAGCA ACCATCAGGGTTCAAAGTCC
Sequence
Wt Sequence (deleted region in lower case, insertion in carrots)
TCATGAGGGTCCCCGGGACGGAGCTCAGGTCATCAGACTTAGTGACAAGTGCCTTTACCTGCTGAGCTAGCTCCTTGGTCCTAACAAACTTTGATTGAGAAACAACAGTTGAGTTGA^GTTGA^TTGGCCCAgtagttttaaaGTCGGGTTTATTGAGACTCAACAAAATAAAGTTTACTCTTTACAAGTTTATTGTGGTTTGAAAACACCAAAGGTTTTGATAAGAGAAATACTTCCATgtagaactggtatgtattagcattagaacataatatcttgtggcttctaaaagcttttgttcttgcatggatactgtgcagttaaaatcattttatgcttatgttttgtgttttgtgggtttttttttttttcattacaagaaagctgctttgcagacaataggagaggaccaaggtcagaacccctatactgaactgctggtactggaggctcatcgcgacattgtccgcttcctggtgaggctcgatgacttcaggtaagaggcttactctgcccagtggtcaatgctgacaaagacgatttagagcattttatgtttaaaacaacttcaaacttaaattatcttttgtaaaaactttCAGAATCCTGAAATATAACCAACTGAAAATTGTAGCATTTAATATTCAGTTGGAATGGACTTTGAACCCTGATGGTAACATGTTTAAATCCTTTGAAATCCATGTCACCTTGTCAGAGTCTGGTTGTCTTGACAATTACATTTGTTTGCTTTTTTTTTTCTTTGATGTTTTGGAAAAAATTGTCATGAGGTTTTAGAAATATTCTTACTACCTTAGAAGAAGCAAATGACTTTAAGATTGAGTTGTAGCTGTCAAATCTGAGAATCAAATATGTATGGAGTTTAATTTAATATTAGATACCCGCTA
391 bp deletion beginning at Chromosome 13 positive strand position 94,978,329 bp and ending after 94,978,719 bp (GRCm38/mm10). In addition, 96 bp before the 391 bp deletion there are 2 small intronic indels, a 5 bp (GTTGA) insertion followed 8 bp after that insertion by an 11 bp deletion (GTAGTTTTAAA) that will not alter the results of the exon deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37958 | GGT TTG AAA ACA CCA AAG GTT | Mutant Forward | A | |||
| 37959 | ACC ATC AGG GTT CAA AGT CC | Common | A | |||
| 37960 | CTG ACA AAG ACG ATT TAG AGC A | Wild type Forward | A | |||
| 37961 | Fluorophore-1 | AGA GAA ATA CTT CCA TGT AGC ATT TAA T | Quencher-1 | MUT Probe | ||
| 37962 | Fluorophore-2 | CAG AAT CCT GAA ATA TAA CCA ACT GA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37958 | 0.40 uM |
| 37959 | 0.40 uM |
| 37960 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.