For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 127 bp
Wild Type = 142 bp
>chr6:126739793-126739934 142bp CCGAGGTGACATGAGATCG CACCAACCTCTCACTACTACAGCA
Sequence
Wt Sequence (deleted region in lower case):
CCGCCAGGTCAGAGCACGGGCCCCACCCTAAAGGAGGGCACAGCCGAAGCTGTGAAGCGGGTGCCGCTCTCTGGAGCTCGTGTCGTGGGCGCCGTCCTAGTGGCGGGGAGCGCACCGCCGAGGTGACATGAGATCGGAGAAATCCCTGAcgctggcggcgccgggggaggtccgtgggccggagggggagcaacaggatgcgggtgagttccaggaggccgagggcggcggcggctgctgtagtagtgagaggttggtgatcaacatctccgggctgcgcttcgagacgcagctgcgcaccctgtcgctgttccctgacacgctgctaggagaccctggccgcagagtccgtttctttgaccccttgaggaacgagtacttctttgaccgcaaccgacccagcttcgacgctatcctttattactatcaatctggaggtcgcctgcgcaggcctgttaatgtgcccctggacatttttatggaagagatccgcttctatcagttgggagaggaagccctggcggccttccgggaggatgagggttgcctgcccgaaggtggcgaggatgagaaaccactcccctcccagcctttccagcgacaggtctggcttctctttgagtacccggagagttccgggcccgcccgaggcatcgccatcgtctcagtattggtcatcctcatctccatcgtcatcttttgcctggagaccttgcctcaattccgtgcagatgggcgcggtggaagcaacgagggtagtgggacccgcttgtctccggcctccaggagccacgaggaagaagatgaggatgaagattcctatgcatttcctggtagcattccctctggggggttggggactggaggaacatcttcacttagtactctcgggggttctttcttcacagaccccttcttcttggtggaaactctgtgtatcgtctggttcacgtttgagctcctggtgcgcttctctgcctgtcccagcaaggcggccttctttcgcaatatcatgaacatcattgacttggtggccattttcccctactttatcaccttgggcaccgagctagtgcaacgtcacgagcagcagtctgtgagtggtggcagtggtcagaatgggcagcaggccatgtccctagccatcctcagggtgatccgcctggtccgggtgttccgaatcttcaagctctcccgccattccaaggggctgcagatcctgggtaagaccttacaggcgtccatgcgggagctcgggctgctcatcttcttcctcttcatcggagtcatcctcttttccagcgctgtctacttcgcagaggctgatgatgttgactcgctcttccctagcatcccagatgccttctggtgggctgtggttacaatgaccacggtaggttatggggacatgtaccccatgacggtagggggcaagattgtgggctcactgtgcgccattgctggggtcctcaccattgcattaccggtaccggtcattgtctccaatttcaactacttctaccaccgagagacggagcaggaggagcaaggccagtatacccacgtcacttgtgggcagcccactccggacttgaaggcaacggacaatgggcttggcaaacctgactttgccgaggcttcacgggaacgccggcccagctaccttccgactccacatcgagcttatgcggagaaaaggatgctcaccgaggttTGATGGATGCGGGCAGGCCTGCAGGAAAACAGGAGCTCTGAGCAAGTCATCTCTCAGGCTTCCTTCTCATGCTCACTACTTCCGCCTTAGCTCCAGAGGACCTCGAACCCCCCTCCCCCCTAACACAGTACATGGCATCTTGGACCAAATATCTGGACTGTAGACTGTTGCTCGATCCTCGCAGCATTCGAGGTTTCTCCATCTTAG
internal deletion beginning at Chromosome 6 negative strand position 126,739,902 bp and ending after 126,738,338 bp (GRCm38/mm10). This mutation deletes 1565 bp of ENSMUSE00000690877 (exon 1)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37246 | CCG AGG TGA CAT GAG ATC G | Common | A | |||
| 37248 | CAC CAA CCT CTC ACT ACT ACA GCA | Wild type Reverse | A | |||
| 37249 | Fluorophore-1 | TGC AGG AAA ACA GGA GCT CT | Quencher-1 | MUT Probe | ||
| 37250 | Fluorophore-2 | AAC AGG ATG CGG GTG AGT T | Quencher-2 | WT Probe | ||
| 37946 | TGG AGC TAA GGC GGA AGT AG | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37246 | 0.40 uM |
| 37248 | 0.40 uM |
| 37946 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.