For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:72069605-72069705 101bp TGTGCTCTTCTTCCGAGAGG ACCCCTGCCCTTCTTAAA
Mutant= 83 bp
Wild Type = 101 bp
Sequence
Wt Sequence: tgtgctcttcttccgagagggtccaccggactcagttatggaagtcggcaaactgcataattctgaaacCAgggacagcagcatttaagaagggc
Mutant Sequence: acgtcaaggttccaccagtcccgagtggtgaccgagtcccacccactccccgcagctgccgttctggtccgcacaacctttcaccctgctgcgggatgagcagagcggcggCAgggacagcagcatttaagaagggc
1370 bp deletion beginning at Chromosome 12 negative strand position 72071005 bp and ending after 72069636 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36666 | TGT GCT CTT CTT CCG AGA GG | Wild type Forward | A | |||
| 36668 | Fluorophore-1 | ACC GGA CTC AGT TAT GGA AGT C | Quencher-1 | WT Probe | ||
| 37860 | GTT CTG GTC CGC ACA ACC | Mutant Forward | A | |||
| 37861 | ACC CCT GCC CTT CTT AAA TG | Common | A | |||
| 37862 | Fluorophore-2 | CTG CGG GAT GAG CAG AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 36666 | 0.40 uM |
| 37860 | 0.40 uM |
| 37861 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.