For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 101 bp
Wild Type = 118 bp
>chr4:150149636+150149753 118bp GCTTCCACTTTCTTCCAGGAG TCCAGGTTCCCCTACACTGA
Sequence
Sequence (deleted region in lower case)
ACCAGATACAACCTCTTCACAACCCTACCTGTCCCTACACCTTCAAGGTCAAAAGCAGGAAAAATGTGTCCCTAGAAACAGGATAACACCTGCTTGGGTCACCTTCCCAGACAGCCCCCTCCTCCTCCTTCCAGGATTAGAGCCTGCTCCCAGCCAGACCTCCCTTTCCACctaaagaggaagtggaggcctggccaccctcaccccaccccaatcctagaagtgacaggagccaaccctacagagtctctgacctcgaaactctctggttcagcgtctgcagcccacactagtcctgactaccctaagtgctgcctttggctcagtcttccagtatggctacaacatcgccgtgatcaacacacctcacaaggtgggcacaaggtgggtctcagcgggtagaagtcagctgctgtctggcttctggaagcttccactttcttccaggagtcccctagatacctacccctaaggactaggggcatctagagccatTTTATCTAGCAATGTCATCTTTTCTAGGGGTATCAGTGTAGGGGAACCTGGATTCTCTGCCTGGGCACCCTGCCTTGCTCACTTGGGAAGGCCATTTGTGGGTGACAGACACATCAAGAATGAACTGTTAACTTTTAGAGATTGTGTTTGGTCAAAGAGAAGCAACAGAGATAAAGGCTGACTGGAGCAAGTTCA
324 bp deletion beginning at Chromosome 4 positive strand position 150,149,378 bp and ending after 150,149,701 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37747 | TCC TCC TTC CAG GAT TAG AGC | Mutant Forward | A | |||
| 37748 | TCC AGG TTC CCC TAC ACT GA | Common | A | |||
| 37749 | GCT TCC ACT TTC TTC CAG GAG | Wild type Forward | A | |||
| 37750 | Fluorophore-1 | CCA GCC AGA CCT CCC TTT | Quencher-1 | MUT Probe | ||
| 37751 | Fluorophore-2 | CTA CCC CTA AGG ACT AGG GGC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37747 | 0.40 uM |
| 37748 | 0.40 uM |
| 37749 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.