For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 124 bp
Wild Type = 118 bp
>chr1:132121962-132122079 118bp GCAGTATCAACAACGGCAGA TCTACAGCAACCACCCTGCT
Sequence
Wt Sequence: AACCAACTCCACACTCAGACGAATGAGGGTGAGGGTCAGGCCACCTAGCTCTTTTCCACCCAGGCTCCCTGTGACCCTGATGACTAGCTGACATTGGgaagaaggggtgggggtgctctgggctgttcacatactctgggtgggaggtagggactgacacttgtcccactcagacatgccactcagtcttgtgggctgtcatcaggcgctttctcccccacagatggcacagatgagcctgagcagctgtctcctggcatgcagtatcaacaacggcagaaccagcgccgattctccatggaggtgagggtgcccctcccgggCTCCATGGGTCACACACGTCCACAGCAGTAAATTTAGCAGGGTGGTTGCTGTAGAGCCTGCCACTGGGGGGCTCAAACTGGTGCAGCTTATGGTGGGGGTTCAGTGAGAATATATGTCAAGTGCTAAAA
Deleted Region: gaagaaggggtgggggtgctctgggctgttcacatactctgggtgggaggtagggactgacacttgtcccactcagacatgccactcagtcttgtgggctgtcatcaggcgctttctcccccacagatggcacagatgagcctgagcagctgtctcctggcatgcagtatcaacaacggcagaaccagcgccgattctccatggaggtgagggtgcccctcccggg
226 bp deletion beginning at Chromosome 1 negative strand position 132,122,242 bp and ending after 132,122,017 bp (GRCm38/mm10). In addition there is a 17 bp intronic deletion 20 bp after the 226 bp deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37058 | AGG CCA CCT AGC TCT TTT CC | Mutant Forward | A | |||
| 37060 | GCA GTA TCA ACA ACG GCA GA | Wild type Forward | A | |||
| 37062 | Fluorophore-1 | CTC CCT GTG ACC CTG ATG A | Quencher-1 | MUT Probe | ||
| 37063 | Fluorophore-2 | CGA TTC TCC ATG GAG GTG A | Quencher-2 | WT Probe | ||
| 37672 | GTG GCA GGC TCT ACA GCA AC | Common | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37058 | 0.40 uM |
| 37060 | 0.40 uM |
| 37672 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.