For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:70505630-70505734 105bp TTTTAGAGTGGGGCATGGTC CCAGGAAAGAGTGGGAGAGG
Mutant= 91 bp
Wild Type = 105 bp
Sequence
Wt Sequence: CTGCCGGGAGCAGGGCGTACTTGAAAGCGAAGTCTAGAAGGGTGGGTAAAAGGATCTGTGACACTGAAGCCTGTCTATTTGGGGGAGTTGGGTAGAGCTGAGGGTGTAGCTTTTAGTAgcagggtagataggtgtagagcagcatgtgaccgtgggcgtggcctggcgggagcagctgtggtgtgaccctccacaagatccctcatttctctgagtgcagagatggttaagcactagctctgtcctgacagacccagtctgtggagttcgggtttgtctctttcgagtcgggggtatcttccacgtagctggagcagggagcgtggtctgcttgtcagcgtgtcgattcagcatcctcccggtccactgcagagctcaccgtcagtacctgctcagtggtcagcactatgacttcccgagttaccggagtgtcgtgcacgaggtgacccaggccttcgccgctgcctcgcgggaggtattggcagtggaagcagagttggcagggcctcgagcgcaaccggtgctcgcccgccacgtgcgcagcctgcaggagctagaacagacgcgcctggccacggtaagaccaccacccctctccttttagagtggggcatggtccacaacccattcccagccaccccgacctactactatttttgccaaacacctctaTGCATTTGGGCCCTCTCCCACTCTTTCCTGGCTAACTACATTTCCCTCCCAAATTTTTGCTTAAT
Deleted Sequence: gcagggtagataggtgtagagcagcatgtgaccgtgggcgtggcctggcgggagcagctgtggtgtgaccctccacaagatccctcatttctctgagtgcagagatggttaagcactagctctgtcctgacagacccagtctgtggagttcgggtttgtctctttcgagtcgggggtatcttccacgtagctggagcagggagcgtggtctgcttgtcagcgtgtcgattcagcatcctcccggtccactgcagagctcaccgtcagtacctgctcagtggtcagcactatgacttcccgagttaccggagtgtcgtgcacgaggtgacccaggccttcgccgctgcctcgcgggaggtattggcagtggaagcagagttggcagggcctcgagcgcaaccggtgctcgcccgccacgtgcgcagcctgcaggagctagaacagacgcgcctggccacggtaagaccaccacccctctccttttagagtggggcatggtccacaacccattcccagccaccccgacctactactatttttgccaaacacctcta
554 bp deletion beginning at Chromosome 8 negative strand position 70,506,214 bp and ending after 70,505,661 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37643 | TTT TAG AGT GGG GCA TGG TC | Wild type Forward | A | |||
| 37644 | CCA GGA AAG AGT GGG AGA GG | Common | A | |||
| 37645 | TGA CAC TGA AGC CTG TCT ATT TG | Mutant Forward | A | |||
| 37648 | Fluorophore-1 | CAG CCA CCC CGA CCT AC | Quencher-1 | WT Probe | ||
| 37650 | Fluorophore-2 | AGT TGG GTA GAG CTG AGG GTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37643 | 0.40 uM |
| 37644 | 0.40 uM |
| 37645 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.