For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:103228230-103228319 90bp TTCAGCTACCCCAGCATCTC TCCTGGGAACAGATGAATCC
Mutant= 106 bp
Wild Type = 90 bp
Sequence
Wt Sequence: TTTTGATGTGGACCTTCAGCCAAGGCAAAAGAAGAGCAGGTTGTCACCTTCAGCTACCCCAGCATCTCTCTAAGCAGCccagggttaggtgggaacatggcagaccgttggggcgaacggattcatctgttcccaggatcggagtgcagcagagccctgtgctctgtcatgactgccaccagggatgagaggagggtggaacagaggagaggtggccattaagacccttcgtaaagtggtgcgttctctccccaggcacggggagcgggtcctttatgcctccgccttctctcctgcagggctgtgtctggctgtccctgacaaaacggtcaaatggtgcgcagtgtcagagcacgagaataccaagtgcatcagcttccgtgaccacatgaagaccgtccttccgcctgatggcccccggcttgcctgtgtgaagaaaacctcctatccggattgcatcaaggccatttctgtaagtcctgctgccgggaacggtagcccctaTACGCCTCTGGTTTGACTCACTTGTGGAAAAAAAAAAATTGAACTGGGGGGTGGGGACTGTCAGGTGTCCAAGT
Deleted Sequence:
ccagggttaggtgggaacatggcagaccgttggggcgaacggattcatctgttcccaggatcggagtgcagcagagccctgtgctctgtcatgactgccaccagggatgagaggagggtggaacagaggagaggtggccattaagacccttcgtaaagtggtgcgttctctccccaggcacggggagcgggtcctttatgcctccgccttctctcctgcagggctgtgtctggctgtccctgacaaaacggtcaaatggtgcgcagtgtcagagcacgagaataccaagtgcatcagcttccgtgaccacatgaagaccgtccttccgcctgatggcccccggcttgcctgtgtgaagaaaacctcctatccggattgcatcaaggccatttctgtaagtcctgctgccgggaacggtagccccta
426 bp deletion beginning at Chromosome 9 negative strand position 103,228,289 bp and ending after 103,227,864 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37632 | TTC AGC TAC CCC AGC ATC TC | Common | A | |||
| 37633 | TCC TGG GAA CAG ATG AAT CC | Wild type Reverse | A | |||
| 37634 | ACT TGG ACA CCT GAC AGT CC | Mutant Reverse | A | |||
| 37635 | Fluorophore-1 | AGG TGG GAA CAT GGC AGA C | Quencher-1 | WT Probe | ||
| 37636 | Fluorophore-2 | CGC CTC TGG TTT GAC TCA CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37632 | 0.40 uM |
| 37633 | 0.40 uM |
| 37634 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.