For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:135518418-135518513 96bp AGCATCAGCAACCCTTACCA GTGCACATGAATCTTCTCAGGA
Mutant= 103 bp
Wild Type = 96 bp
Sequence
Wt Sequence: GACACCATGCCTGCTCTAGCTCAGCTGTATTTGTATTCTGCACTGTGCACTCACCAAATGTTGCTTTAGTTTTAGGGATATTGGACAATTcttcccagaagtctttgcacctggtggtcatcctcctcctgatcctgagtctggcagcttccgtgctgagctcagtgttcaccttctacaacagcatcagcaacccttaccagacgttcctgggacctatgggtgtctatacctggaatggactcagCGGTGAGTTTCCTGAGAAGATTCATGTGCACACACATGCATACACATACATATGCATACATATGTACACCTGCACACATAGATGTATACACA
Deleted Sequence: cttcccagaagtctttgcacctggtggtcatcctcctcctgatcctgagtctggcagcttccgtgctgagctcagtgttcaccttctacaacagcatcagcaacccttaccagacgttcctgggacctatgggtgtctatacctggaatggactcag
157 bp deletion beginning at Chromosome 7 negative strand position 135,518,605 bp and ending after 135,518,449 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37617 | AGC ATC AGC AAC CCT TAC CA | Wild type Forward | A | |||
| 37618 | GTG CAC ATG AAT CTT CTC AGG A | Common | A | |||
| 37619 | GCT CAG CTG TAT TTG TAT TCT GC | Mutant Forward | A | |||
| 37620 | Fluorophore-1 | CCT ATG GGT GTC TAT ACC TGG AAT | Quencher-1 | WT Probe | ||
| 37621 | Fluorophore-2 | CTG TGC ACT CAC CAA ATG TTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37617 | 0.40 uM |
| 37618 | 0.40 uM |
| 37619 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.