Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr6:30912310-30912419 110bp TGAGTTATGGGCACCTAAGTTAC CATCCAGGTGCATTACTGACTC
Mutant= 102 bp
Wild Type = 110 bp
Wt Sequence: GGATATGATGCATCTATTTGAGTTATGGGCACCTAAGTTACTAACCTCTCGAGTTAAGTTCCCaaacttaaacggagtgagtctgtggacctgcagaaatgctcaggagtcagtaatgcacctggatgtcccactcccttttcaggtttcaagaagtcagtggatcaaagcctgtgggaaatgtctctattaggtttgagaaacaactaggtcaagatgatgaagaggtaagaagacaaaacaacagcaacagccttatatgtccctatgtcatctttccttgggattgcttaaactatcttacaagtagtgggcttgtaaacttcctatgtaaaagcaaaggtgaacaaacatttatatacagagtgaagttaatgtattccatttttgaaaaaggaacagagaagttgaggcggtaacAAGGGTATATCATCAACAAATCAAGACACAAAACTGAAAACCACTTA
Mutant Sequence: aaacttaaacggagtgagtctgtggacctgcagaaatgctcaggagtcagtaatgcacctggatgtcccactcccttttcaggtttcaagaagtcagtggatcaaagcctgtgggaaatgtctctattaggtttgagaaacaactaggtcaagatgatgaagaggtaagaagacaaaacaacagcaacagccttatatgtccctatgtcatctttccttgggattgcttaaactatcttacaagtagtgggcttgtaaacttcctatgtaaaagcaaaggtgaacaaacatttatatacagagtgaagttaatgtattccatttttgaaaaaggaacagagaagttgaggcggtaac
357 bp deletion beginning at Chromosome 6 negative strand position 30,912,374 bp and ending after 30,912,018 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000289889 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 64 bp before the exon deletion there is an indel consisting of a 4 bp insertion, ATAT, and a 7 bp deletion, CGCAAGA
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37488 | TGA GTT ATG GGC ACC TAA GTT AC | Common | A | |||
| 37489 | CAT CCA GGT GCA TTA CTG ACT C | Wild type Reverse | A | |||
| 37490 | CTT CCT ATG GTA AGT GGT TTT CAG T | Mutant Reverse | A | |||
| 37491 | Fluorophore-1 | CGG AGT GAG TCT GTG GAC CT | Quencher-1 | WT Probe | ||
| 37492 | Fluorophore-2 | AGG GTA TAT CAT CAA CAA ATC AAG ACA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37488 | 0.40 uM |
| 37489 | 0.40 uM |
| 37490 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.